User: Assa Yeroslaviz

gravatar for Assa Yeroslaviz
Assa Yeroslaviz1.4k
Reputation:
1,370
Status:
Trusted
Location:
Munich, Germany
Last seen:
1 month, 2 weeks ago
Joined:
12 years, 4 months ago
Email:
f*****@gmail.com

Posts by Assa Yeroslaviz

<prev • 280 results • page 1 of 28 • next >
0
votes
1
answers
109
views
1
answers
Comment: C: differential expression analysis of cell subtypes mixture
... Thanks Michael for this suggestion. This is one function I haven't seen before. Looking at the `?unmix` information, I was wondering if I understand it correctly.  Using this would mean that in `x` are my samples with the mixed population and `pure` are the samples withe only one subtype. Is this c ...
written 12 weeks ago by Assa Yeroslaviz1.4k
0
votes
1
answers
109
views
1
answers
Comment: C: differential expression analysis of cell subtypes mixture
... Thanks for the fast response. This is what i also thought. I still doubt though, that this is what they are looking for. Maybe a little more background information would help. The experiment is about dendrites in drosophila's brains. We are interested in a neural population which is responsible for ...
written 12 weeks ago by Assa Yeroslaviz1.4k
0
votes
1
answers
96
views
1
answers
Comment: C: Unmix() function in DeSeq capabilities
... this is a similar situation to our case with the mixture of samples (from the original post you mentioned). I was wondering if it is possible to artificially add RNA from tissue X to the second batch of samples (tussues A or B) to create a base line for this changes. similar to Spike-Ins used in a ...
written 3 months ago by Assa Yeroslaviz1.4k
0
votes
0
answers
75
views
0
answers
Using edgeR to analyze Cripsr/Cas9 Screening data
... I am having trouble understanding the workflow described in the paper. I have a data set of four fastq files from a crispr/cas9 screening experiment as well as a fasta file of the sgRNA used in the analysis (for an example see below). The experiment uses single-indexing strategy with two control sam ...
edger processamplicons sgrna crispr written 3 months ago by Assa Yeroslaviz1.4k
0
votes
0
answers
57
views
0
answers
using the edgeR for sgRNA workflow with my own data
... I am having trouble understanding the workflow described in the paper. I have a data set of four fastq files from a crispr/cas9 screening experiment as well as a fasta file of the sgRNA used in the analysis (for an example see below). The experiment uses single-indexing strategy with two control sam ...
edger processamplicons sgrna written 3 months ago by Assa Yeroslaviz1.4k
0
votes
1
answer
109
views
1
answer
differential expression analysis of cell subtypes mixture
... I have a data set of two different cell lines compositions for a developmental assay in Drosophila. By itself it wouldn't be so difficult to analyze it, but the problem is in the composition of each of the cell lines.  The first cell line has four different subtypes (A,B,C,D) the second one has onl ...
edger deseq2 design matrix multifactorial design written 3 months ago by Assa Yeroslaviz1.4k • updated 3 months ago by Aaron Lun19k
0
votes
1
answers
114
views
1
answers
Comment: C: duplicated row names when creating DESeqDataSetFromMatrix
... Do the column names needs to differ?   ...
written 3 months ago by Assa Yeroslaviz1.4k
1
vote
1
answer
114
views
1
answer
duplicated row names when creating DESeqDataSetFromMatrix
... Hi, I am working with a workflow for Cripr/Cas9 screening and try to analyze the data with `DESeq2`. my count table looks like that: > head(countdata) CTRL CTRL TREAT TREAT BAX_GAAACATGTCAGCTGCCACT 87 267 511 353 BAX_GAACTCACCCCTGAAGCAAA 340 474 772 1063 B ...
deseq2 deseqdatasetfrommatrix duplicate written 3 months ago by Assa Yeroslaviz1.4k • updated 3 months ago by James W. MacDonald46k
0
votes
2
answers
224
views
2
answers
Comment: C: How do I extract the complete MsaAAMultipleAlignment object to a file
... thanks, this was very helpful.  ...
written 5 months ago by Assa Yeroslaviz1.4k
0
votes
2
answers
224
views
2
answers
Comment: C: How do I extract the complete MsaAAMultipleAlignment object to a file
... I have a two other questions 1. is it possible to set the numbers of letters in each row?  For now it depends on the windows size (AFAIK), but I would like to set it to 60 (e.g). is it possible? 2. Is it possible to put the name of the organisms at the beginning of the row and not at the end? th ...
written 5 months ago by Assa Yeroslaviz1.4k

Latest awards to Assa Yeroslaviz

Popular Question 12 months ago, created a question with more than 1,000 views. For DESeq2 results with RUVSeq values
Good Answer 12 months ago, created an answer that was upvoted at least 5 times. For A: Problem with biomart's listMarts function
Popular Question 12 months ago, created a question with more than 1,000 views. For simpleafy plots
Voter 12 months ago, voted more than 100 times.
Popular Question 12 months ago, created a question with more than 1,000 views. For DESeq2 produces adjusted p-values = 1
Popular Question 12 months ago, created a question with more than 1,000 views. For coefficients meaning in time course analysis with DESeq2
Appreciated 14 months ago, created a post with more than 5 votes. For A: Problem with biomart's listMarts function
Popular Question 14 months ago, created a question with more than 1,000 views. For extract intensity values from AffyBatch
Popular Question 16 months ago, created a question with more than 1,000 views. For DESeq2 produces adjusted p-values = 1
Appreciated 2.1 years ago, created a post with more than 5 votes. For A: Problem with biomart's listMarts function
Popular Question 2.1 years ago, created a question with more than 1,000 views. For DESeq2 produces adjusted p-values = 1
Popular Question 2.1 years ago, created a question with more than 1,000 views. For could not find symbol "keepNA" in environment of the generic function
Good Answer 2.1 years ago, created an answer that was upvoted at least 5 times. For A: Problem with biomart's listMarts function
Supporter 2.3 years ago, voted at least 25 times.
Teacher 2.5 years ago, created an answer with at least 3 up-votes. For A: Problem with biomart's listMarts function
Teacher 2.6 years ago, created an answer with at least 3 up-votes. For A: Problem with biomart's listMarts function
Popular Question 2.7 years ago, created a question with more than 1,000 views. For could not find symbol "keepNA" in environment of the generic function
Scholar 2.9 years ago, created an answer that has been accepted. For A: could not find symbol "keepNA" in environment of the generic function
Centurion 4.0 years ago, created 100 posts.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 271 users visited in the last hour