User: Aditya

gravatar for Aditya
Aditya70
Reputation:
70
Status:
Trusted
Location:
Germany
Last seen:
23 hours ago
Joined:
4 years, 3 months ago
Email:
a*************@mpi-bn.mpg.de

Posts by Aditya

<prev • 26 results • page 1 of 3 • next >
0
votes
1
answer
27
views
1
answer
Is mm10.p6 available as BSgenome?
... [BSgenome.Mmusculus.UCSC.mm10][2] contains mm10 ([2012 version][1]). Is [mm10.patch 6 - 2017][3]: also available as a BSgenome? [1]: https://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20/ [2]: https://bioconductor.org/packages/release/data/annotation/html/BSgenome.Mmusculus.UCSC.mm10.html [ ...
bsgenome.mmusculus.ucsc.mm10 written 2 days ago by Aditya70 • updated 19 hours ago by James W. MacDonald50k
0
votes
0
answers
14
views
0
answers
vcountPDict: full versus masked BSgenome
... Is vcountPDict identical when performed against full or masked BSgenome? Any performance benefit for masked BSgenome? Small example below suggests it doesn't matter, is that conclusion generalizable? # Function to count genome matches count_genome_matches <- function(cas9seqs, bsgen ...
0
votes
1
answer
40
views
1
answers
Comment: C: vcountPDict fails on PDict
... Oh, thank you Herve :-) ...
written 7 days ago by Aditya70
0
votes
0
answers
46
views
0
answers
Comment: C: getBSgenome{Bsgenome}: avoid attaching BiocGenerics (and others)
... This works, but relies on using (BioC non-complyingly) non-exported functionality - can this be done better? bsname <- BSgenome:::.getInstalledPkgnameFromProviderVersion('mm10') bsgenome <- utils::getFromNamespace(bsname, bsname) ...
written 7 days ago by Aditya70
0
votes
0
answers
46
views
0
answers
getBSgenome{Bsgenome}: avoid attaching BiocGenerics (and others)
... Is there a way to avoid BiocGenerics, S4Vectors, IRanges, and Biostrings from being attached when calling BSgenome::getBSgenome() ? bsgenome <- BSgenome::getBSgenome('mm10') Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: c ...
bsgenome bsgenome.mmusculus.ucsc.mm10 written 7 days ago by Aditya70
0
votes
1
answer
60
views
1
answers
Comment: C: How to subset a BSgenome
... Thank you Lori :-) . ...
written 14 days ago by Aditya70
0
votes
1
answer
40
views
1
answer
vcountPDict fails on PDict
... # vcountPDict on a DNAStringSet works bsgenome <- BSgenome.Mmusculus.UCSC.mm10::Mmusculus seqs <- c("CTTATATTGTCTCCAGCAGAAGG", "CTTATATTGTCTCCAGCAGAAGG", "ATATTGTCAAGTTGACAACCAGG") Biostrings::vcountPDict( Biostrings::DNAStringSet(seqs), bsgenome, min.m ...
biostrings written 15 days ago by Aditya70 • updated 7 days ago by Hervé Pagès ♦♦ 14k
1
vote
1
answer
60
views
1
answer
How to subset a BSgenome
... # Load a BSgenome object bs <- BSgenome.Mmusculus.UCSC.mm10::Mmusculus # Extracting a single chromosome works fine bs[['chr1']] bs[['chr2']] # Question: how to take a BSgenome subset? bs[c('chr1', 'chr2')] Error in bsgenome[c("chr1", "chr2")] : object of type 'S ...
bsgenome bsgenome.mmusculus.ucsc.mm10 written 15 days ago by Aditya70 • updated 15 days ago by shepherl ♦♦ 1.4k
0
votes
1
answer
126
views
1
answers
Comment: C: Biostrings regex matching
... Thank you Herve :-). ...
written 10 weeks ago by Aditya70
4
votes
1
answer
126
views
1
answer
Biostrings regex matching
... How to do Biostrings regex matching? chr1 <- BSgenome.Mmusculus.UCSC.mm10::Mmusculus$chr1 Biostrings::countPattern('AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA', chr1) [1] 363 Biostrings::countPattern('A{44}', chr1, fixed = FALSE) Error in .Call2("new_XString_from_ ...
biostrings written 11 weeks ago by Aditya70 • updated 10 weeks ago by Hervé Pagès ♦♦ 14k

Latest awards to Aditya

Student 11 months ago, asked a question with at least 3 up-votes. For Best way to convert uniprot accessions to entrez gene identifiers in R
Popular Question 11 months ago, created a question with more than 1,000 views. For Error: hgu95av2PFAM is defunct
Supporter 11 months ago, voted at least 25 times.
Great Question 11 months ago, created a question with more than 5,000 views. For Best way to convert uniprot accessions to entrez gene identifiers in R
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Best way to convert uniprot accessions to entrez gene identifiers in R
Scholar 4.1 years ago, created an answer that has been accepted. For A: DAVIDWebService$new(): Error: .jinit(...) == 0 is not TRUE
Scholar 4.3 years ago, created an answer that has been accepted. For A: DAVIDWebService$new(): Error: .jinit(...) == 0 is not TRUE

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 297 users visited in the last hour