filter and trim large fasta/bam files
0
0
Entering edit mode
achaillon • 0
@achaillon-14117
Last seen 8 months ago

Hi

I am analyzing deep sequencing data and I would like to manipulate these large data  (>100,000 reads - can be either fasta or bam format) to do the followings:

#1 - Exclude primer sequences (short strings of 25-30 nt) 

e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' and 'CAACCTTTTAATCTAACCAAAAAAAC'  

#2 - Filter out the short reads (< a 100 bp)?

#3 - And finally exclude reverse oriented sequences?

I am using outside R tools (samtools) but it would be great to have all running in R...

thanks in advance!

a

deep sequencing fasta bam trim • 464 views
ADD COMMENT

Login before adding your answer.

Traffic: 516 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6