The support.bioconductor.org editor has been updated to markdown! Please see more info at: Tutorial: Updated Support Site Editor

Question: filter and trim large fasta/bam files
0
gravatar for achaillon
16 months ago by
achaillon0
achaillon0 wrote:

Hi

I am analyzing deep sequencing data and I would like to manipulate these large data  (>100,000 reads - can be either fasta or bam format) to do the followings:

#1 - Exclude primer sequences (short strings of 25-30 nt) 

e.g. if I want to exclude all the match 'CAAACTCAAATCTAATCTAACCAAAAAAAC' and 'CAACCTTTTAATCTAACCAAAAAAAC'  

#2 - Filter out the short reads (< a 100 bp)?

#3 - And finally exclude reverse oriented sequences?

I am using outside R tools (samtools) but it would be great to have all running in R...

thanks in advance!

a

bam fasta deep sequencing trim • 230 views
ADD COMMENTlink modified 16 months ago • written 16 months ago by achaillon0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 240 users visited in the last hour