Question: CRISPRseek offTargetAnalysis errors
gravatar for joyce
12 months ago by
joyce0 wrote:

Hi Julie,

We have been running offTargetAnalysis on a large set of sequences.  For some of the sequences, we ran into the following 2 kinds of error messages:


Searching for gRNAs ...
Error in .Call2("new_XStringSet_from_CHARACTER", ans_class, ans_elementType, :
key 69 (char 'E') not in lookup table
Calls: offTargetAnalysis ... XStringSet -> XStringSet -> .charToXStringSet -> .Call2 -> .Call

I checked the sequences affected by this error and did not see any 'E' in there.  Could you please tell me what might have caused this error?


Building feature vectors for scoring ...
Calculating scores ...
Error in `$<`(`*tmp*`, score, value = c(0.0831847889825708, :
replacement has 405816 rows, data has 405817
Calls: offTargetAnalysis -> getOfftargetScore2 -> $<- -> $<

Could you please tell me what to do to correct this?

Thank you very much!


crisprseek • 287 views
ADD COMMENTlink modified 12 months ago • written 12 months ago by joyce0
Answer: CRISPRseek offTargetAnalysis error
gravatar for Julie Zhu
12 months ago by
Julie Zhu3.9k
United States
Julie Zhu3.9k wrote:
Joyce, The post at an erro related with RNAStringSet seems to suggest that there are non-DNA characters in your input sequences. Could you please post a couple of sequences for me to reproduce the error you encountered? Thanks! Best regards, Julie From: "joyce [bioc]" <> Reply-To: "" <> Date: Friday, January 12, 2018 at 10:47 AM To: "Zhu, Lihua (Julie)" <> Subject: [bioc] CRISPRseek offTargetAnalysis error Activity on a post you are following on<https:""> User joyce<https:"" u="" 14189=""/> wrote Question: CRISPRseek offTargetAnalysis error <https:"" p="" 104833=""/> : Hi Julie, We have been running offTargetAnalysis on a large set of sequences. For some of the sequences, we ran into the following error message: Searching for gRNAs ... Error in .Call2("new_XStringSet_from_CHARACTER", ans_class, ans_elementType, : key 69 (char 'E') not in lookup table Calls: offTargetAnalysis ... XStringSet -> XStringSet -> .charToXStringSet -> .Call2 -> .Call I checked these sequences and did not see any 'E' in there. Could you please tell me what might have caused this error? Thanks! Joyce ________________________________ Post tags: CRISPRseek You may reply via email or visit CRISPRseek offTargetAnalysis error
ADD COMMENTlink written 12 months ago by Julie Zhu3.9k
Hi Julie, Here are two DNA sequences that incur the error: seq1: ATGGCTTCACAGCTGCCTTTTCCTGCAGACGACTTCGGTATCTACTATGTCCT seq2: ATGGCGGATATGGAGGACCTTTTCGGGAGCGACGTCGACAGTGATGCTGAGCGTAAAG Thanks for your help! Joyce Joyce On Fri, Jan 12, 2018 at 11:07 AM, Julie Zhu [bioc] <> wrote: > Activity on a post you are following on > > User Julie Zhu <https:"" u="" 3596=""/> wrote Answer: > CRISPRseek offTargetAnalysis error > <https:"" p="" 104833="" #104836="">: > > Joyce, The post at an erro related with RNAStringSet > <https:"" p="" 44320=""/> seems to suggest that there > are non-DNA characters in your input sequences. Could you please post a > couple of sequences for me to reproduce the error you encountered? Thanks! > Best regards, Julie From: "joyce [bioc]" <> > Reply-To: "" <reply+35eaaf5d+code@>> Date: Friday, January 12, 2018 at 10:47 AM To: "Zhu, > Lihua (Julie)" <> Subject: [bioc] CRISPRseek > offTargetAnalysis error Activity on a post you are following on ><https:""> User > joyce<https:"" u="" 14189=""/> wrote Question: > CRISPRseek offTargetAnalysis error <https:""> p="" 104833=""/> : Hi Julie, We have been running offTargetAnalysis on a > large set of sequences. For some of the sequences, we ran into the > following error message: Searching for gRNAs ... Error in > .Call2("new_XStringSet_from_CHARACTER", ans_class, ans_elementType, : key > 69 (char 'E') not in lookup table Calls: offTargetAnalysis ... XStringSet > -> XStringSet -> .charToXStringSet -> .Call2 -> .Call I checked these > sequences and did not see any 'E' in there. Could you please tell me what > might have caused this error? Thanks! Joyce ________________________________ > Post tags: CRISPRseek You may reply via email or visit CRISPRseek > offTargetAnalysis error <https:"" p="" 104833=""/> > > ------------------------------ > > Post tags: CRISPRseek > > You may reply via email or visit https://support.bioconductor. > org/p/104833/#104836 >
ADD REPLYlink written 12 months ago by joyce0
Joyce, I tested the two sequences and both worked for me. library(CRISPRseek) library("BSgenome.Mmusculus.UCSC.mm10") FYI, I used CRISPRseek_1.18.0 and Biostrings_2.46.0. Please make sure that you have the right version of the packages installed. offTargetAnalysis(DNAStringSet("ATGGCTTCACAGCTGCCTTTTCCTGCAGACGACTTCGGTATCTACTATGTCCT"), outputDir="~/Desktop/test", gRNAoutputName="testSeq1forJoy", BSgenomeName=Mmusculus, annotateExon=FALSE, chromToSearch="chr1")) Searching for gRNAs ... >>> Finding all hits in sequence chr1 ... >>> DONE searching Building feature vectors for scoring ... Calculating scores ... Annotating, filtering and generating reports ... Done annotating Add paired information... Add RE information... write gRNAs to bed file... Done. Please check output files in directory ~/Desktop/test/ $summary names gRNAsPlusPAM top5OfftargetTotalScore top10OfftargetTotalScore top1Hit.onTarget.MMdistance2PAM topOfftarget1MMdistance2PAM 1 NA_gR32f CCTTTTCCTGCAGACGACTTNGG 3.3 3.3 perfect match not found 11,9 2 NA_gR22r CCGAAGTCGTCTGCAGGAAANGG 0.2 0.2 perfect match not found 18,9,7 topOfftarget2MMdistance2PAM topOfftarget3MMdistance2PAM topOfftarget4MMdistance2PAM topOfftarget5MMdistance2PAM topOfftarget6MMdistance2PAM 1 17,13,6 12,8,5 2 offTargetAnalysis(DNAStringSet("ATGGCGGATATGGAGGACCTTTTCGGGAGCGACGTCGACAGTGATGCTGAGCGTAAAG"), outputDir="~/Desktop/test", gRNAoutputName="testSeq2forJoy", BSgenomeName=Mmusculus, annotateExon=FALSE, chromToSearch="chr1") Validating input ... Searching for gRNAs ... >>> Finding all hits in sequence chr1 ... >>> DONE searching Building feature vectors for scoring ... Calculating scores ... Annotating, filtering and generating reports ... Done annotating Add paired information... Add RE information... write gRNAs to bed file... Done. Please check output files in directory ~/Desktop/test/ $summary names gRNAsPlusPAM top5OfftargetTotalScore top10OfftargetTotalScore top1Hit.onTarget.MMdistance2PAM topOfftarget1MMdistance2PAM 1 NA_gR21f CGGATATGGAGGACCTTTTCNGG 2.6 2.6 perfect match not found 20,16,13 2 NA_gR20f GCGGATATGGAGGACCTTTTNGG 0.6 0.6 perfect match not found 19,12,5 topOfftarget2MMdistance2PAM topOfftarget3MMdistance2PAM topOfftarget4MMdistance2PAM topOfftarget5MMdistance2PAM topOfftarget6MMdistance2PAM 1 2 19,10,5 18,6,5 topOfftarget7MMdistance2PAM topOfftarget8MMdistance2PAM topOfftarget9MMdistance2PAM topOfftarget10MMdistance2PAM REname 1 2 Best, Julie From: "joyce [bioc]" <> Reply-To: "" <> Date: Friday, January 12, 2018 at 12:09 PM To: "Zhu, Lihua (Julie)" <> Subject: [bioc] C: CRISPRseek offTargetAnalysis errors Activity on a post you are following on<https:""> User joyce<https:"" u="" 14189=""/> wrote Comment: CRISPRseek offTargetAnalysis errors<https:"" p="" 104833="" #104839="">: Hi Julie, Here are two DNA sequences that incur the error: seq1: ATGGCTTCACAGCTGCCTTTTCCTGCAGACGACTTCGGTATCTACTATGTCCT seq2: ATGGCGGATATGGAGGACCTTTTCGGGAGCGACGTCGACAGTGATGCTGAGCGTAAAG Thanks for your help! Joyce Joyce On Fri, Jan 12, 2018 at 11:07 AM, Julie Zhu [bioc] <> wrote: > Activity on a post you are following on > > User Julie Zhu <https:"" u="" 3596=""/> wrote Answer: > CRISPRseek offTargetAnalysis error > <https:"" p="" 104833="" #104836="">: > > Joyce, The post at an erro related with RNAStringSet > <https:"" p="" 44320=""/> seems to suggest that there > are non-DNA characters in your input sequences. Could you please post a > couple of sequences for me to reproduce the error you encountered? Thanks! > Best regards, Julie From: "joyce [bioc]" <> > Reply-To: "" <reply+35eaaf5d+code@>> Date: Friday, January 12, 2018 at 10:47 AM To: "Zhu, > Lihua (Julie)" <> Subject: [bioc] CRISPRseek > offTargetAnalysis error Activity on a post you are following on ><https:""> User > joyce<https:"" u="" 14189=""/> wrote Question: > CRISPRseek offTargetAnalysis error <https:""> p="" 104833=""/> : Hi Julie, We have been running offTargetAnalysis on a > large set of sequences. For some of the sequences, we ran into the > following error message: Searching for gRNAs ... Error in > .Call2("new_XStringSet_from_CHARACTER", ans_class, ans_elementType, : key > 69 (char 'E') not in lookup table Calls: offTargetAnalysis ... XStringSet > -> XStringSet -> .charToXStringSet -> .Call2 -> .Call I checked these > sequences and did not see any 'E' in there. Could you please tell me what > might have caused this error? Thanks! Joyce ________________________________ > Post tags: CRISPRseek You may reply via email or visit CRISPRseek > offTargetAnalysis error <https:"" p="" 104833=""/> > > ------------------------------ > > Post tags: CRISPRseek > > You may reply via email or visit https://support.bioconductor. > org/p/104833/#104836 > ________________________________ Post tags: CRISPRseek You may reply via email or visit C: CRISPRseek offTargetAnalysis errors
ADD REPLYlink written 12 months ago by Julie Zhu3.9k
Hi Julie, Thanks for looking into this issue for me. Before I received your response to my question, I edited the post and added another question (B) on a different error message. You might not have seen it. I copied it below: (B) *Building feature vectors for scoring ...* *Calculating scores ...* *Error in `$<`(`*tmp*`, score, value = c(0.0831847889825708, :* *replacement has 405816 rows, data has 405817* *Calls: offTargetAnalysis -> getOfftargetScore2 -> $<- -> $<* Could you please tell me what to do to correct this? Thanks, Joyce
ADD REPLYlink written 12 months ago by joyce0
Joyce, Could you please send me the input data that causes this error? Thanks! Best regards, Julie From: "joyce [bioc]" <> Reply-To: "" <> Date: Sunday, January 14, 2018 at 7:08 PM To: "Zhu, Lihua (Julie)" <> Subject: [bioc] C: CRISPRseek offTargetAnalysis errors Activity on a post you are following on<https:""> User joyce<https:"" u="" 14189=""/> wrote Comment: CRISPRseek offTargetAnalysis errors<https:"" p="" 104833="" #104860="">: Hi Julie, Thanks for looking into this issue for me. Before I received your response to my question, I edited the post and added another question (B) on a different error message. You might not have seen it. I copied it below: (B) *Building feature vectors for scoring ...* *Calculating scores ...* *Error in `$<`(`*tmp*`, score, value = c(0.0831847889825708, :* *replacement has 405816 rows, data has 405817* *Calls: offTargetAnalysis -> getOfftargetScore2 -> $<- -> $<* Could you please tell me what to do to correct this? Thanks, Joyce ________________________________ Post tags: CRISPRseek You may reply via email or visit C: CRISPRseek offTargetAnalysis errors
ADD REPLYlink written 12 months ago by Julie Zhu3.9k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 210 users visited in the last hour