using the edgeR for sgRNA workflow with my own data
0
0
Entering edit mode
Assa Yeroslaviz ★ 1.5k
@assa-yeroslaviz-1597
Last seen 9 weeks ago
Munich, Germany

I am having trouble understanding the workflow described in the paper. I have a data set of four fastq files from a crispr/cas9 screening experiment as well as a fasta file of the sgRNA used in the analysis (for an example see below). The experiment uses single-indexing strategy with two control samples and two treated samples.

I am not sure how to use the workflow described in the paper and the R vignette to analyze my data. I have read both the paper and the vignette, but I still don't understand how to adapt my data to the example in there. 

I know, I need to trim the fastq files to contain only the sgRNA part of the reads. 

What I don;t understnad are the two text files for the `processAmplicons()` function. Where do I get the `Samples4.txt` and the `sgRNAs4.txt`. What is the third column in the second file? is it already the counts? 

 

I would appreciate the suggestions on how to proceed.

 

thanks

Assa

The fastq files withe the complete read (sgRNA is highlighted)

ctrl1
@M01100:33:000000000-A9U6C:1:1101:12325:1758 1:N:0:1
CTTCTTTCTTGTGGAAAGGACGAAACACCGGTGGGCTGCAAATCCAAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT
+
1>A>11BDFF1DB1B111A1B000AACCE?0A///BE//011BBGA110AFFHHFFBBGHFF1BFFGFFFBBGGD2@FFGB11FGFAGGG?GH/?222BB@
@M01100:33:000000000-A9U6C:1:1101:17009:1766 1:N:0:1
GCCCCTTCTTGTGGAAAGGACGAAACACCGAGGGATGTTATCTCCTCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCACCTT
+
1111>>FFFF1F11111111B000AAEFE?00///B/BD2FEGGBABE/AEEGG2F11EG1B111D1@F110FF@221B11110B10FE@/FG/?B220BB
@M01100:33:000000000-A9U6C:1:1101:13526:1767 1:N:0:1
CCTTAGTCTTGTGGAAAGGACGAAACACCGCGCGCGCGGCGCCCACAGTTTAGAGCTAGAAATAGCAAGTTAAAATAGGCTAGTCCGTTATCAACTTGAA
+
11AA11BDFF1F11ADB111BA00EEFHE?00/AA/E/A>/>>@/?/>FGH211BEFF111BBEG11>FGFB22>BBGFFFFFGDE?GG?F>22<BB111
---------------
ctrl2
@M01100:32:000000000-AAD7V:1:1101:13689:1787 1:N:0:1
CCAGGTTCTTGTGGAAAGGACGAAACACCGTCCCGAAGGCTCCTCACCGGTTTTAGAGTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG
+
>>111BDFFFFFB1111111B00AEABFFAGCEE/////ABECGF1AF/?EEGGBF1EF2F2EGGBFHF@FHHFHHGGHHHHGHFHHHHGHHGHHHDHHHH
@M01100:32:000000000-AAD7V:1:1101:14753:1826 1:N:0:1
ATGATATCTTGTGGAAAGGACGAAACACCGGCGTCGAGGAAGCGTAACTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT
+
1>11>3DFFFFFFCBDBCABFA00AAFFEE0A/EA?/EECFFEEGCCEGHHHHHGHBGGHFFFFGGGHHHHHHHHHHHHHHHHHHHHHHHGHHGHHHHHHH
@M01100:32:000000000-AAD7V:1:1101:14960:1844 1:N:0:1
GTCGCCTCTTGTGGAAAGGACGAAACACCGGAGAGCATGGCAGTACACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT
+
AAAA3AAAFFFFGCFFFFF4BA2A2ACGFE222222FGHHHHGHFHEAAEFGGGGHFHFGFHHHHGGFHHHHHHHHHHGHHHHHGHHHHHGHHGHHHHHHH

the fastA file with the sgRNA used in the library

>ENSG00000139083_GCCTGCTCAGTGTAGCATTA
gcctgctcagtgtagcatta
>ENSG00000139083_GGGAACATGAAGTGGCGTCG
gggaacatgaagtggcgtcg
>ENSG00000139083_GTGAGTGTTCGTGACCCGAG
gtgagtgttcgtgacccgag
>ENSG00000139083_GAGGAAGCGTAACTCGGCAC
gaggaagcgtaactcggcac
edger sgrna processamplicons • 374 views
ADD COMMENT

Login before adding your answer.

Traffic: 488 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6