Is there any way to blast my nucleotide sequence only against specific NCBI database, for example, refseq_rna?

Similarly, I'd like to limit my search to a specific organism/taxid.

As I understand, blastSequences() doesn't have these options now. Is there any other solution?

Note that blastSequences is just doing a query to the NCBI blast API, as noted in the help page for the function. Because of that, you can only make the queries that are amenable to the API. You can for example query on a different database (again, as noted in the help page):

>  blastSequences(x = "GGCCTTCATTTACCCAAAATG", database = "reseq_rna")
estimated response time 45 seconds
list()

But there isn't any facility, so far as I can tell, to specify the organism.