Search
Question: Error in gmapR: gsnap not functioning
0
gravatar for Amer Ghalawinji
22 days ago by
Amer Ghalawinji0 wrote:

Hey,

I'm trying to preform a bisulfite alignment using gmapR package. This is my code:

=========================

library("gmapR")

ggd<-GmapGenomeDirectory(file.path(getwd(),"indices"), create=T)

gg<-GmapGenome(file.path(getwd(),"test.fa"), directory=ggd, name="seq", create=T)

cmet_index <- cmetindex(gg)

gsnapPar <- GsnapParam(genome=gg, unique_only=FALSE, suboptimal_levels=2L, npaths=1000L, novelsplicing=FALSE,clip_overlap=FALSE, mode="cmet-stranded") 

gsnapOutput<- gsnap(input_a="/primers/Fprimers.fasta",input_b="/primers/Rprimers.fasta", params=gsnapPar, output = "primer.out")

================================

Everything is going well until starting the alignment using gsnap function so I am getting the follwoing error:

######

Error in .system_gsnap(commandLine("gsnap")) :
  Execution of gsnap failed, command-line: /lib/R/library/gmapR/usr/bin/gsnap --db=seq --dir=/indices --suboptimal-levels=2 --mode=cmet-stranded --npaths=1000 --format=sam --split-output=primer.out  /primers/Fprimers.fasta primers/Rprimers.fasta 2> /tmp/RtmpmHpuzf/gsnap-stderr2e90db57601log'; last output line: 'Cannot find genomic index files in either current or old format'

 

######

Any advice?

Thanks in advance!

Best,

Amer

 

 

ADD COMMENTlink modified 21 days ago by Michael Lawrence10k • written 22 days ago by Amer Ghalawinji0

If you look in /indices, do you see a seq directory with files in it? I'm guessing something is just getting confused about the paths.
 

ADD REPLYlink written 22 days ago by Michael Lawrence10k

yes inside indices directory i have seq directory and it includes the following files:

seq.maps (empty directory)

seq.chromosome

seq.chromosome.iit

seq.chrsubset

seq.contig

seq.contig.iit

seq.genomebits

seq.genomecomp

seq.ref153positions

seq.ref12153bitpackcomp

seq.ref12153bitpackptrs

seq.ref12153gammaptrs

seq.ref12153offsetscomp

seq.saindex

seq.salcpcomp

seq.salcpptrs

seq.sarray

seq.version

=====

beside seq directory, indices directory includes the following files as well:

seq.metct153positions

seq.metct12153bitpackcomp

seq.metct12153bitpackptrs

seq.metga153positions

seq.metga12153bitpackcomp

seq.metga12153bitpackptrs

 

I found someone had the same problem but with no clear way how he solved it:

http://seqanswers.com/forums/archive/index.php/t-58056.html

 

 

ADD REPLYlink written 21 days ago by Amer Ghalawinji0

Are you able to provide something reproducible?

ADD REPLYlink written 21 days ago by Michael Lawrence10k

it's not the elegant way but let's try with it (or by email?)

Fprimers.fasta:

>1
ggtggaattttgtgttagttttgggt

 

===============

Rprimers.fasta:

>1
aactttccacctaactactaccctta

 

===========

test.fa (RefGenome):

>seqasdf
AGACAAAACAGAAAACTTTATGGAAGATAAAATAAGAATAACAAAATCTTTCCCAAAGAGAAAGACCATTAAATTTTTGT
ATATATCCTTCCAGAGAATACACAAATTATATGTATATATATTTTACATGTATACATATATAACAAAGACTAGCTTATAC
TACCCACGCTTTCCTGTCATTTTTCTTTTCTACCTAAGATATCACTGACAGTCTTTTATATAATAAGGATAGTCCTCAAT
TATCATCATTGTTTAAATGGAATTCTAATGTGTTAAGTGCCATAAATTAGCAGATTCTCTATTGATAGACATTTAGCTTA
CTTTTCACATTCTCACTATGAGTAATGCTAAGAAGGCAATATAGTTCTTGCACCTTCATGAACATATTCTTTTATGCTAT
GTGCATTATTTTGGGTCAAAGGGCAAGCAGAGTTTCATTTAATTTTGTTTTAGACATGGGCTATATATTGACAAATTGCC
CTCCCAGGAACAGTACACAGTTTTTCTTATGTTGCCTCACCCATGCCAGCAGTAGCTAGAAAATGCATTTCCAAAGACTG
GTGCTAATTTTCTGTGCATTCTGTGAGTGCTCAGTCAATTTAAGCAATAACCACTTAGAGTAACAAAATCTATTCACCCT
AATAGCAGAGATTTCTACTTCATCCCTGGCTCACTGCCCAACTTTTGATCTCATCTAAGGCCAATAAATGTAGCTCCAGA
CAAGTGACACAGGTAGCTCTGTCCCCATCCAATCTACCCAGCTACTTCTCTTAAGGCACGTTCTGATCCTTCAAGCATGA
AGTTCTTGCCTCTGGCTTTTGTTTCTCTCTTGTTTCTGGCTTCAGTGACCTTGAGTACCCTGGAATCTTCCATATTGAGA
AAGAAATGATAGAGGGGAGGGGACATGGAAAAAAGAATTAAATATATCTATTTTTAAAAAGAAAGAAAATTTTAGAATGG
ACATGTCTAGAAGGAGGAGGAAACAGAGGAGGGGGACAGGTATAAAAACTGGACTTCTCTGAATATACTCTGCTTTGAAG
GTTTGACTTTGGAATCATCTACATATTTTATCTAATACAAGAATATCGAAACTTAAATGGCAATCCCAAAAATCTAAAAG
GAATAGAAATCAAATTAGCCTCTGTAATAAATGGGTTGTATAACCACACAAAGGACTATTTGAAATGACTTTCAAAGAGT
AATTTGAGAATACTTCCTTATTGGAATATAACCTAAAAACAGAAGAATTGCAAACTGTTTTCAATGTTTTCAGTAATCAT
ATTGAGACTTTAATACATATATTGTGGGATAAAGGAAATGAATGTTGGTGTCACTGATAGAGATAAGAAATAAAAGTTCA
GGTAAAAATTCTGTAAATCCTAAATTTGAATTGGAATTTTATATTTTATTTTTAAAATACCTTTTTCTACCCCCATCCAC
TGAAAAGCCCTAGAAATATTGGCCAACCTAGTAGAAATGATTTCCCTCTCACCCGGGATATTATCTCTAAATATAATTTA
CCAAAGTCTTATTGAAGAAATTGCTGTTTCTGAGCTTGAAGCAACTATACAAATGTACCTGGAAGATTTTACCATACTGG
AAAAAAGCAGCTTGACAAAGACTACTGAAGTCATGTCAAAAAAAACAAAGAAGTCAACTTGAAGGGGCTTTCTCTTGGCA
AAGATGGGAAAATGTGAACCTTGATAAAAAATAATTGCATGCATTATTCACAGTAACCAAGATATGTAATCCACCTAGGT
GTCTATGGATGGATAAATATATAAAGAAAATGTGATATACACAATGAAATATTATTCAGCCTTTAAAAAGAAAGAAATCC
TGCCATTTGTGACAACACAGATGAACCTGGAGGACATTATGCTAAGTGAAATAAGCCAGACACAGGCAGACAAATACTGA
ATGATCTCACCTATGTGTGGAATCTTAAAATGTCAAACTCATGGACACAGAGAGTAGGATGGTGGTTACCAAGGGAGTTG
AGGGAAATGAAGAAGTACTAGTCAAAGGGTACAAAGTTTCCGTTATGCAGGGTGAATAAGTTCGGGAGCTTACTGCATAG
CACAGTGACTACAGTTAATAATACTGTGTTGTATACTTGAAATTTGCTAAGAGTAGATCTTAAATATTGTTACCACAGAA
AAAAATGGTGACTATGAGAGGTGATGAATATGTTAATTAGCTTGATAGTGGTAATCATGTCACAATGTATATGTCTATCA
AAACATCACATTGTACGTCTTAAATATGTACAATTATTATTTGTCAATTATACCTCAATAAAGCTGGAAACATAAAAATA
AAATAACTACAATTAATTGAAACATATCAAACATGTCCAAAACTGATAAAGAAAGGTAAAGAATTTGGCCTGGCACAGCG
GCTCACACCTGCAATCTCAGCAGTTTGGGATGCCAAGGCAGGCGGATCACCTGAGGTCAGGAGTTTGAGACCAGCCTGGC
CAATATAGCAAAACCCCATCTCTACTAAAAATACAAAAATTAGCTAGGCGTGGTAGCGGGCATCTGTAGTTCCAGCTACT
ACTCAGGAGGCTGAGATAGAGAATCACTTGAACCCAGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCCACTATACTCCA
GCCTGGGTGACAAAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAGAAAGAAAGAAAAGTGAAGAATTTATCCTGGCTTT
TCTGTAAAAACTGCACCTCAGAAGAACCAAATTATTGATAAGGAATTTTGCTCTTTAGAAATATTTCCAGCTAATAAATG
AAGGAATAATAGCATTGAGACAAATCGCCATTTTGTAATCTCAGGTGAATTTACGGATCTAGGCAATGATCATTAATGGC
TGAGAAAATCACAACAAAAAGAACAATTAGACATTTGTGCCTCCTGATAGAAGTATACAATATCACCTTCAAAGCTATTT
TGCCAAAAAAGAAAAAAAAAATCAACCCAAATCTAATCAAGGCTCCCACTCTAACTCCCAAGCTCTAGGATATACCAAGG
ACAAAGGAAGATCATGAAATACCACCATGGGGATTCAATCAGCAAATTCTGAAATGCAACATTATCCTTCACCCTGCTTG
GCCTAAAAGTACAAAATAACACGAGGAAAAATTAGTTTCCAGAGCCTGTTATATTTTGAAAAATCATCAGAAAACTGAGA
ATCAAGGATAGAATTTCTAGAAAGTTCCTTCCCCTAAAGCTTTCACACTTGCCTCAGTGTATATATGTGGCTATACCACT
GACAGGCCGCCAGTCATTAAATTCAAGCTCCAAGAGACAAACTCTTGAAAAAAAGGCAGCCTAGGAGAAAGCAACATGAT
TTTTCACATATTTTAACTTGGTTTTTCTCATAAAATGGTTTCTGAATGTTTCTTAGCTTTCAATGGGCAATAAATAACTT
TTAGGGAAATAGATGTGAGCCAATCTGAGGAAGTATTTGAGATGAAGAGAAGGCTTTGCTGTCTATGAGGAGTGCATTAG
AATAGAATCGCTCCAGGAAAAGGTCACCTGTGTTGATTGCCTTTATGAGGTGACATTTAAATAAAAGTACTCGTTCAGTT
TTCATTGAAAAACATTAAAAGACATCTCCAAAAATTTTTTTGGGAATGTGAGAAACTCTGCTGCACAAATGATCATGTTT

 

 

ADD REPLYlink written 21 days ago by Amer Ghalawinji0
0
gravatar for Michael Lawrence
21 days ago by
United States
Michael Lawrence10k wrote:

Thanks for the reproducible example. Turns out this was a bug in gmapR, where the cmet index files were being written to the wrong directory. I pushed a fix to both devel and release (1.24.1). You can either way a couple days for the fix or just move the cmet files from "indices" to "indices/seq".

ADD COMMENTlink written 21 days ago by Michael Lawrence10k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 376 users visited in the last hour