Question on AffyBatch
1
0
Entering edit mode
@gunther-honing-1868
Last seen 9.7 years ago
Dear list, I'm trying to find out the following in an AffyBatch. To get the indices from a loction on a chip I use the function xy2i() for the hgu133plus2 by Affymetrix. But now I want to know the name of the probe located at this spot. How can this be done? And what about the locations used as QC? Gunther
hgu133plus2 probe hgu133plus2 probe • 1.0k views
ADD COMMENT
0
Entering edit mode
@wolfgang-huber-3550
Last seen 24 days ago
EMBL European Molecular Biology Laborat…
Gunther H?ning wrote: > Dear list, > > I'm trying to find out the following in an AffyBatch. > > To get the indices from a loction on a chip I use the function xy2i() for > the hgu133plus2 by Affymetrix. > But now I want to know the name of the probe located at this spot. How can > this be done? > And what about the locations used as QC? > > Gunther Hi Gunther, maybe this is what you want, it finds you the annotation of the probe at x-position 'mx' and y-position 'my', and its intensity data in the AffyBatch 'a': library("hgu133plus2probe") library("hgu133plus2cdf") mx = 600 my = 713 exprs(a)[xy2i(mx, my), ] r = with(hgu133plus2probe, x==mx & y==my) print.data.frame( hgu133plus2probe[r,] ) sequence x y Probe.Set.Name 249549 GTAGACTACAAGTGGTTGTTACCCA 600 713 213376_at Probe.Interrogation.Position Target.Strandedness 249549 870 Antisense The explicit call to 'print.data.frame' is necessary because the print method for 'probetable' objects is a bit dumb. Best wishes Wolfgang > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor
ADD COMMENT
0
Entering edit mode
Hi, that's exactly what I was looking for. Thanks. Gunther -----Urspr?ngliche Nachricht----- Von: Wolfgang Huber [mailto:huber at ebi.ac.uk] Gesendet: Donnerstag, 7. September 2006 07:50 An: Gunther H?ning Cc: bioconductor at stat.math.ethz.ch Betreff: Re: [BioC] Question on AffyBatch Gunther H?ning wrote: > Dear list, > > I'm trying to find out the following in an AffyBatch. > > To get the indices from a loction on a chip I use the function xy2i() > for the hgu133plus2 by Affymetrix. > But now I want to know the name of the probe located at this spot. How > can this be done? > And what about the locations used as QC? > > Gunther Hi Gunther, maybe this is what you want, it finds you the annotation of the probe at x-position 'mx' and y-position 'my', and its intensity data in the AffyBatch 'a': library("hgu133plus2probe") library("hgu133plus2cdf") mx = 600 my = 713 exprs(a)[xy2i(mx, my), ] r = with(hgu133plus2probe, x==mx & y==my) print.data.frame( hgu133plus2probe[r,] ) sequence x y Probe.Set.Name 249549 GTAGACTACAAGTGGTTGTTACCCA 600 713 213376_at Probe.Interrogation.Position Target.Strandedness 249549 870 Antisense The explicit call to 'print.data.frame' is necessary because the print method for 'probetable' objects is a bit dumb. Best wishes Wolfgang > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: > http://news.gmane.org/gmane.science.biology.informatics.conductor
ADD REPLY

Login before adding your answer.

Traffic: 524 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6