Entering edit mode
Hi Vincent,
On 04/05/2010 08:26 PM, Vincent Davis wrote:
> I did read the section on Loops-and-conditional-execution but I did
not see
> any mention of using multiple lines. Ideally I read the whole
R-intro. @Martin
> Morgan Thanks for your help.
> http://cran.fhcrc.org/doc/manuals/R-intro.html#Loops-and-
conditional-execution
It doesn't have much to do with Loops-and-conditional-execution. Just
the simple fact that in R, when you want to put several expressions on
the same line, you must put an ; between them:
## doesn't work:
print(fasta.seq) fasta.seq<- read.FASTA.entry(con)
## work:
print(fasta.seq); fasta.seq<- read.FASTA.entry(con)
Cheers,
H.
>
> *Vincent Davis
> 720-301-3003 *
> vincent at vincentdavis.net
> my blog<http: vincentdavis.net=""> |
> LinkedIn<http: www.linkedin.com="" in="" vincentdavis="">
>
>
> On Mon, Apr 5, 2010 at 9:09 PM, Martin Morgan<mtmorgan at="" fhcrc.org="">
wrote:
>
>> Hi Vincent --
>>
>> On 04/05/2010 07:57 PM, Vincent Davis wrote:
>>> I very new to R and having a little trouble with CdfEnvAffy, I am
going
>>> thought the
>>
>> Might help to read through
>>
>> http://cran.fhcrc.org/doc/manuals/R-intro.html
>>
>> (also available by typing help.start() in to your R session).
>>
>>> Here are my steps
>>>> fasta.filename<- system.file("/Users/vmd/Dropbox/dna/toxodb/",
>>> "TgondiiME49Genomic_ToxoDB-6.0.fasta", package = "altcdfenvs")
>>>> con<- file(fasta.filename, open = "r")
>>> Warning message:
>>> In file(fasta.filename, open = "r") :
>>> file("") only supports open = "w+" and open = "w+b": using the
former
>>>
>>> #### Not sure what to do about this error so I just removed,<open =="">> "r">,
>>> this seems to be ok
>>>
>>>> con<- file(fasta.filename)
>>>
>>> #### This is where I am really stuck
>>>
>>>> while (!is.null(fasta.seq$header)) {print(fasta.seq) fasta.seq<-
>>> read.FASTA.entry(con)}
>>> Error: unexpected symbol in "while (!is.null(fasta.seq$header))
>>> {print(fasta.seq) fasta.seq"
>>
>> This is saying that you cannot write
>>
>> print(fasta.seq) fasta.seq<- read.FASTA.entry(con)
>>
>> on a single line -- it is a syntax error and would normally be
written
>> on two separate lines
>>
>> while (!is.null(fastq.seq$header)) {
>> print(fasta.seq)
>> fasta.seq<- read.FASTA.entry(con)
>> }
>>
>> Martin
>>
>>> #### So I tried this and it is better but still not right
>>>> while (!is.null(fasta.seq$header)) {print(fasta.seq) (fasta.seq<-
>>> read.FASTA.entry(con))}
>>> FASTA sequence:
>>> >gnl|UG|Hs#S1730546 membrane-spanning 4-domains, subfamily A
...
>>> AACCCATTTCAACTGCCTATTCAGAGCATGCAGTAAGAGGAAATCCACCAAGTCTCAATA
...
>>> Error: attempt to apply non-function
>>>
>>>
>>> So I am not sure how to get this to work.
>>> Thanks
>>> Vincent
>>>
>>>
>>>> sessionInfo()
>>> R version 2.10.1 (2009-12-14)
>>> x86_64-apple-darwin9.8.0
>>>
>>> locale:
>>> [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
>>>
>>> attached base packages:
>>> [1] stats graphics grDevices utils datasets methods
base
>>>
>>> other attached packages:
>>> [1] altcdfenvs_2.8.0 hypergraph_1.18.0 graph_1.24.4
>>> makecdfenv_1.24.0 affyio_1.14.0
>>> [6] matchprobes_1.18.0 Biostrings_2.14.12 IRanges_1.4.16
>>> AnnotationDbi_1.8.2 affy_1.24.2
>>> [11] Biobase_2.6.1
>>>
>>> loaded via a namespace (and not attached):
>>> [1] DBI_0.2-5 preprocessCore_1.8.0 RSQLite_0.8-4
>>> tools_2.10.1
>>>
>>>
>>>
>>> *Vincent Davis
>>> 720-301-3003 *
>>> vincent at vincentdavis.net
>>> my blog<http: vincentdavis.net=""> |
>>> LinkedIn<http: www.linkedin.com="" in="" vincentdavis="">
>>>
>>> [[alternative HTML version deleted]]
>>>
>>> _______________________________________________
>>> Bioconductor mailing list
>>> Bioconductor at stat.math.ethz.ch
>>> https://stat.ethz.ch/mailman/listinfo/bioconductor
>>> Search the archives:
>> http://news.gmane.org/gmane.science.biology.informatics.conductor
>>
>>
>> --
>> Martin Morgan
>> Computational Biology / Fred Hutchinson Cancer Research Center
>> 1100 Fairview Ave. N.
>> PO Box 19024 Seattle, WA 98109
>>
>> Location: Arnold Building M1 B861
>> Phone: (206) 667-2793
>>
>
> [[alternative HTML version deleted]]
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at stat.math.ethz.ch
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives:
http://news.gmane.org/gmane.science.biology.informatics.conductor
--
Hervé Pagès
Program in Computational Biology
Division of Public Health Sciences
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N, M2-B876
P.O. Box 19024
Seattle, WA 98109-1024
E-mail: hpages at fhcrc.org
Phone: (206) 667-5791
Fax: (206) 667-1319
