Hi Vincent, On 04/05/2010 08:26 PM, Vincent Davis wrote: > I did read the section on Loops-and-conditional-execution but I did not see > any mention of using multiple lines. Ideally I read the whole R-intro. @Martin > Morgan Thanks for your help. > http://cran.fhcrc.org/doc/manuals/R-intro.html#Loops-and- conditional-execution It doesn't have much to do with Loops-and-conditional-execution. Just the simple fact that in R, when you want to put several expressions on the same line, you must put an ; between them: ## doesn't work: print(fasta.seq) fasta.seq<- read.FASTA.entry(con) ## work: print(fasta.seq); fasta.seq<- read.FASTA.entry(con) Cheers, H. > > *Vincent Davis > 720-301-3003 * > vincent at vincentdavis.net > my blog<http: vincentdavis.net=""> | > LinkedIn<http: www.linkedin.com="" in="" vincentdavis=""> > > > On Mon, Apr 5, 2010 at 9:09 PM, Martin Morgan<mtmorgan at="" fhcrc.org=""> wrote: > >> Hi Vincent -- >> >> On 04/05/2010 07:57 PM, Vincent Davis wrote: >>> I very new to R and having a little trouble with CdfEnvAffy, I am going >>> thought the >> >> Might help to read through >> >> http://cran.fhcrc.org/doc/manuals/R-intro.html >> >> (also available by typing help.start() in to your R session). >> >>> Here are my steps >>>> fasta.filename<- system.file("/Users/vmd/Dropbox/dna/toxodb/", >>> "TgondiiME49Genomic_ToxoDB-6.0.fasta", package = "altcdfenvs") >>>> con<- file(fasta.filename, open = "r") >>> Warning message: >>> In file(fasta.filename, open = "r") : >>> file("") only supports open = "w+" and open = "w+b": using the former >>> >>> #### Not sure what to do about this error so I just removed,<open =="">> "r">, >>> this seems to be ok >>> >>>> con<- file(fasta.filename) >>> >>> #### This is where I am really stuck >>> >>>> while (!is.null(fasta.seq$header)) {print(fasta.seq) fasta.seq<- >>> read.FASTA.entry(con)} >>> Error: unexpected symbol in "while (!is.null(fasta.seq$header)) >>> {print(fasta.seq) fasta.seq" >> >> This is saying that you cannot write >> >> print(fasta.seq) fasta.seq<- read.FASTA.entry(con) >> >> on a single line -- it is a syntax error and would normally be written >> on two separate lines >> >> while (!is.null(fastq.seq$header)) { >> print(fasta.seq) >> fasta.seq<- read.FASTA.entry(con) >> } >> >> Martin >> >>> #### So I tried this and it is better but still not right >>>> while (!is.null(fasta.seq$header)) {print(fasta.seq) (fasta.seq<- >>> read.FASTA.entry(con))} >>> FASTA sequence: >>> >gnl|UG|Hs#S1730546 membrane-spanning 4-domains, subfamily A ... >>> AACCCATTTCAACTGCCTATTCAGAGCATGCAGTAAGAGGAAATCCACCAAGTCTCAATA ... >>> Error: attempt to apply non-function >>> >>> >>> So I am not sure how to get this to work. >>> Thanks >>> Vincent >>> >>> >>>> sessionInfo() >>> R version 2.10.1 (2009-12-14) >>> x86_64-apple-darwin9.8.0 >>> >>> locale: >>> [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 >>> >>> attached base packages: >>> [1] stats graphics grDevices utils datasets methods base >>> >>> other attached packages: >>> [1] altcdfenvs_2.8.0 hypergraph_1.18.0 graph_1.24.4 >>> makecdfenv_1.24.0 affyio_1.14.0 >>> [6] matchprobes_1.18.0 Biostrings_2.14.12 IRanges_1.4.16 >>> AnnotationDbi_1.8.2 affy_1.24.2 >>> [11] Biobase_2.6.1 >>> >>> loaded via a namespace (and not attached): >>> [1] DBI_0.2-5 preprocessCore_1.8.0 RSQLite_0.8-4 >>> tools_2.10.1 >>> >>> >>> >>> *Vincent Davis >>> 720-301-3003 * >>> vincent at vincentdavis.net >>> my blog<http: vincentdavis.net=""> | >>> LinkedIn<http: www.linkedin.com="" in="" vincentdavis=""> >>> >>> [[alternative HTML version deleted]] >>> >>> _______________________________________________ >>> Bioconductor mailing list >>> Bioconductor at stat.math.ethz.ch >>> https://stat.ethz.ch/mailman/listinfo/bioconductor >>> Search the archives: >> http://news.gmane.org/gmane.science.biology.informatics.conductor >> >> >> -- >> Martin Morgan >> Computational Biology / Fred Hutchinson Cancer Research Center >> 1100 Fairview Ave. N. >> PO Box 19024 Seattle, WA 98109 >> >> Location: Arnold Building M1 B861 >> Phone: (206) 667-2793 >> > > [[alternative HTML version deleted]] > > _______________________________________________ > Bioconductor mailing list > Bioconductor at stat.math.ethz.ch > https://stat.ethz.ch/mailman/listinfo/bioconductor > Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor -- Hervé Pagès Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M2-B876 P.O. Box 19024 Seattle, WA 98109-1024 E-mail: hpages at fhcrc.org Phone: (206) 667-5791 Fax: (206) 667-1319