Hi all!

I was puzzled by an error message I got in Gviz adding an AlignmentsTrack representing RNA-seq data:

Error in .Call(.NAME, ..., PACKAGE = PACKAGE) :
  negative length vectors are not allowed

After looking through some code and testing stuff I got to the root of the problem, the sequenceLayer function in GenomicAlignments. To me it looks like there is a pointer problem or something similar in the C-code of that function (an index exceeding the maximal representable number?). Now, my question is, whether this can be fixed in the C-code, or whether I have to find a workaround to identify such cases and eventually down-sample reads in such cases.

The error can be reproduced with the following code:

library(GenomicAlignments)

Seq <- DNAStringSet("GGTTGACATATGGAGCATAGCCAATAAATCCTCCTGAATTCAGATAGCGTTTCCCAATGTGCACAACAGGATACTTGTCTGCTAGTCTTTTATCTGGCCA")
Cig <- "30M3640N70M"

## That works
tmp <- sequenceLayer(rep(Seq, 500000), rep(Cig, 500000))

## Failure:
tmp <- sequenceLayer(rep(Seq, 700000), rep(Cig, 700000))

Error in .Call(.NAME, ..., PACKAGE = PACKAGE) :
  negative length vectors are not allowed

Any help appreciated

cheers, jo

My R/session:

> sessionInfo()
R version 3.2.2 (2015-08-14)
Platform: x86_64-apple-darwin15.0.0/x86_64 (64-bit)
Running under: OS X 10.11.2 (El Capitan)

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets
[8] methods   base     

other attached packages:
 [1] GenomicAlignments_1.6.1    Rsamtools_1.22.0          
 [3] Biostrings_2.38.0          XVector_0.10.0            
 [5] SummarizedExperiment_1.0.1 Biobase_2.30.0            
 [7] GenomicRanges_1.22.1       GenomeInfoDb_1.6.1        
 [9] IRanges_2.4.1              S4Vectors_0.8.2           
[11] BiocGenerics_0.16.1       

loaded via a namespace (and not attached):
[1] bitops_1.0-6         futile.options_1.0.0 zlibbioc_1.16.0     
[4] futile.logger_1.4.1  BiocParallel_1.4.0   lambda.r_1.1.7      

The problem was actually in Biostrings::replaceAt(). Fixed in Biostring 2.38.2 (release) and 2.39.2 (devel).

Cheers,

H.