xy2i in SNps...
0
0
Entering edit mode
@mayte-suarez-farinas-694
Last seen 11.2 years ago
Hi, I know it have been a lot of questions about the xy2i function in the mailing list, but I could not find my answer, so I am writting to ask your help. I am working with SNPs chips, speciffically, the 10K. I made the CDF packages and read the CEL files with ReadAffy function. While trying to read the sequence information in the CDF files, and crosschecking with the affy object, I got the following result: index<-indexProbes(my.snp,which='both') i<-index[['SNP_A-1513509A']] cbind(i2xy(i),i) x y i [1,] 257 307 202264 ***** [2,] 403 433 285318 ***** [3,] 528 237 156475 [4,] 586 453 298661 [5,] 73 393 258668 [6,] 594 359 236817 [7,] 435 473 311670 [8,] 254 349 229897 [9,] 529 399 263072 [10,] 358 529 348441 [11,] 257 308 202922 ****** [12,] 403 434 285976 ****** [13,] 528 238 157133 [14,] 586 454 299319 [15,] 73 394 259326 [16,] 594 360 237475 [17,] 435 474 312328 [18,] 254 350 230555 [19,] 529 400 263730 [20,] 358 530 349099 But in the CDF file, the information for SNP_A-1513509A is: (I include only 4 probes ) Cell1=257 308 CTTTGTAAAACGCTGATAGAAGAAT SNP_A-1513509A 202921 Cell2=257 307 CTTTGTAAAACGGTGATAGAAGAAT SNP_A-1513509A 202263 Cell3=403 434 TTGTAAAACGGTCATAGAAGAATCC SNP_A-1513509A 285975 Cell4=403 433 TTGTAAAACGGTGATAGAAGAATCC SNP_A-1513509A 285317 The result is the same if I use the fucntion indices2xy(i,abatch=my.snp,xy.offset=0) and the following if I considered xy.offset=1. But none of them coincide with the CDF. x y i [1,] 258 308 202264 [2,] 404 434 285318 [3,] 529 238 156475 [4,] 587 454 298661 [5,] 74 394 258668 [6,] 595 360 236817 [7,] 436 474 311670 [8,] 255 350 229897 [9,] 530 400 263072 [10,] 359 530 348441 [11,] 258 309 202922 [12,] 404 435 285976 [13,] 529 239 157133 [14,] 587 455 299319 [15,] 74 395 259326 [16,] 595 361 237475 [17,] 436 475 312328 [18,] 255 351 230555 [19,] 530 401 263730 [20,] 359 531 349099 So, I don't know if the SNPs handle the index and position in a diferent manner or something else. Any help will be welcome! Thanks in advance!!! Mayte ------------------------ Mayte Suarez-Farinas The Rockefeller University 1230 York Avenue, Box 212 New York, NY 10021 phone: 1-212-327-8186 fax: 1-212-327-7422
cdf cdf • 1.2k views
ADD COMMENT

Login before adding your answer.

Traffic: 1606 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6