Hello everyone,

I'm trying to get some sequences surrounding SNPs, but I get the error message below. Any solutions?

Error message:

Error in .processResults(postRes, mart = mart, sep = sep, fullXmlQuery = fullXmlQuery, : 
The query to the BioMart webservice returned an invalid result.
The number of columns in the result table does not equal the number of attributes in the query.
Please report this on the support site at http://support.bioconductor.org

Rep example:

snp_mart <- biomaRt::useMart("ENSEMBL_MART_SNP", dataset = "hsapiens_snp")


getBM(
  mart = snp_mart,
  attributes = c("refsnp_id",
                 "allele",
                 "upstream_flank",
                 "downstream_flank"
                 ), 
  filters = "snp_filter",
  values = "rs580060"   
)

Session info:

R version 4.0.2 (2020-06-22)
Platform: x86_64-apple-darwin17.0 (64-bit)
Running under: OS X Snow Leopard 12.6.1

Matrix products: default
LAPACK: /Library/Frameworks/R.framework/Versions/4.0/Resources/lib/libRlapack.dylib

locale:
[1] en_GB.UTF-8/en_GB.UTF-8/en_GB.UTF-8/C/en_GB.UTF-8/en_GB.UTF-8

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
[1] dplyr_1.1.1    biomaRt_2.46.3

loaded via a namespace (and not attached):
 [1] progress_1.2.2       tidyselect_1.2.0     xfun_0.37            repr_1.1.4           purrr_1.0.1          vctrs_0.6.1         
 [7] generics_0.1.3       BiocFileCache_1.14.0 htmltools_0.5.2      stats4_4.0.2         yaml_2.2.1           base64enc_0.1-3     
[13] utf8_1.2.2           blob_1.2.2           XML_3.99-0.8         rlang_1.1.0          pillar_1.9.0         glue_1.6.2          
[19] withr_2.5.0          DBI_1.1.2            rappdirs_0.3.3       dbplyr_2.1.1         BiocGenerics_0.36.1  bit64_4.0.5         
[25] lifecycle_1.0.3      stringr_1.5.0        evaluate_0.20        memoise_2.0.1        Biobase_2.50.0       knitr_1.37          
[31] tzdb_0.2.0           IRanges_2.24.1       fastmap_1.1.0        curl_4.3.2           parallel_4.0.2       fansi_1.0.3         
[37] AnnotationDbi_1.52.0 Rcpp_1.0.8.3         readr_2.1.1          openssl_2.0.0        cachem_1.0.6         S4Vectors_0.28.1    
[43] vroom_1.5.7          jsonlite_1.8.4       bit_4.0.4            askpass_1.1          hms_1.1.1            digest_0.6.29       
[49] stringi_1.7.6        cli_3.6.1            tools_4.0.2          magrittr_2.0.3       tibble_3.2.1         RSQLite_2.2.9       
[55] crayon_1.5.2         tidyr_1.3.0          pkgconfig_2.0.3      ellipsis_0.3.2       xml2_1.3.3           prettyunits_1.1.1   
[61] skimr_2.1.3          assertthat_0.2.1     rmarkdown_2.20       httr_1.4.5           rstudioapi_0.13      R6_2.5.1            
[67] compiler_4.0.2

The error message could be a lot more helpful here, but the manual page for getSequence() says:

'gene_flank': gives the flanking region of the gene excluding the UTRs, this must be accompanied with a given value for the upstream or downstream attribute

If I add the upstream argument I get:

plain_mart <- biomaRt::useMart("ENSEMBL_MART_ENSEMBL", dataset = "hsapiens_gene_ensembl")

biomaRt::getSequence( 
  id = "BRCA1", 
  type = "hgnc_symbol", 
  seqType = "gene_flank", 
  coding,coding_transcript_flank,coding_gene_flank,transcript_flank,gene_flank,peptide, 3utr or 5utr
  mart = plain_mart,
  upstream = 50
)
#>                                           gene_flank hgnc_symbol
#> 1 TGATTTCCTATTCTGAGAGGCTATTGCTCAGCGGTTTCCGTGGCAACAGT       BRCA1