Search
Question: CRISPRseek CFD score
0
gravatar for joyce
8 months ago by
joyce0
joyce0 wrote:

Hi Julie,

I am using offTargetAnalysis function with CFD scoring method (CRISPRseek verison 1.16.0 from bioconductor) to select a few best-scoring gRNAs for each of a large set of sequences.  In the past, I have used the combination of gRNAefficacy and top10OfftargetTotalScore in the summary file as criteria for selection.  I wonder whether there are updated version of CRISPRseek that provides a single score that combine the gRNA efficacy and the off-target scores for each gRNA. 

On another note, in several recent jobs, I set annotateExon = TRUE, but I did not see any notation in either the "inExon" or the "inIntron" column in the OfftargetAnalysis.xls file.  Did I miss something?  The script I used is copied below:

results=offTargetAnalysis("exon.fasta", findgRNAsWithREcutOnly = FALSE, annotateExon = TRUE, findPairedgRNAOnly = FALSE, exportAllgRNAs="fasta", txdb= txdb, max.mismatch = 3, BSgenomeName = ss, outputDir = ".", overwrite = TRUE, scoring.method="CFDscore")

Thank you very much for your help!

Joyce

 

 

 

 

 

 

ADD COMMENTlink modified 8 months ago by Julie Zhu3.8k • written 8 months ago by joyce0

Hi Julie,

I don't find the exon annotation in the OfftargetAnalysis.xls file.  I list the information you requested below:

(1) > sessionInfo()

R version 3.4.1 (2017-06-30)

Platform: x86_64-pc-linux-gnu (64-bit)

Running under: CentOS Linux 7 (Core)

 

Matrix products: default

BLAS/LAPACK: /n/app/openblas/0.2.19/lib/libopenblas_core2p-r0.2.19.so

 

locale:

[1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              

[3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    

[5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   

[7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 

[9] LC_ADDRESS=C               LC_TELEPHONE=C            

[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       

 

attached base packages:

[1] stats     graphics  grDevices utils     datasets  methods   base     

 

loaded via a namespace (and not attached):

[1] Rcpp_0.12.13               AnnotationDbi_1.38.2      

[3] XVector_0.16.0             GenomicAlignments_1.12.2

[5] GenomicRanges_1.28.6       BiocGenerics_0.22.1       

[7] zlibbioc_1.22.0            IRanges_2.10.5            

[9] BiocParallel_1.10.1        bit_1.1-12                

[11] lattice_0.20-35            rlang_0.1.2               

[13] blob_1.1.0                 GenomeInfoDb_1.12.3       

[15] tools_3.4.1                grid_3.4.1                

[17] SummarizedExperiment_1.6.5 parallel_3.4.1            

[19] Biobase_2.36.2             DBI_0.7                   

[21] matrixStats_0.52.2         bit64_0.9-7               

[23] digest_0.6.12              tibble_1.3.4              

[25] Matrix_1.2-10              GenomeInfoDbData_0.99.0   

[27] rtracklayer_1.36.6         S4Vectors_0.14.7          

[29] bitops_1.0-6               RCurl_1.95-4.8            

[31] biomaRt_2.32.1             memoise_1.1.0             

[33] RSQLite_2.0                DelayedArray_0.2.7        

[35] compiler_3.4.1             Rsamtools_1.28.0          

[37] GenomicFeatures_1.28.5     Biostrings_2.44.2         

[39] XML_3.98-1.9               stats4_3.4.1   

(2) test sequence

"TTACTGCTGTTGACAAGTTGGTTTAAGGGACAAAACTTTAAGTGTTAAAGCCACCTCAACAATTGATTGGACTTTTTCGTTTAATTT"

(3) txdb: https://s3.amazonaws.com/ffcf3-11.1/txdb

(4) ss: https://s3.amazonaws.com/ffcf3-11.1/ss

Thanks!

Best,

Joyce

ADD REPLYlink written 8 months ago by joyce0
Joyce, Please post the code for setting ss and txdb. What you posted is the amazon objects which I do not have access to. Thanks! Best regards, Julie
ADD REPLYlink modified 8 months ago • written 8 months ago by Julie Zhu3.8k

Joyce,

I tried offtarget analysis with your test sequence and human genome. I  was able to generate the InExon information. Here is the code snippet.

Best regards,

Julie

   library(CRISPRseek)

    library("BSgenome.Hsapiens.UCSC.hg19")

    library(TxDb.Hsapiens.UCSC.hg19.knownGene)

    library(org.Hs.eg.db)

    outputDir <- getwd()

    inputFilePath <- DNAStringSet("TTACTGCTGTTGACAAGTTGGTTTAAGGGACAAAACTTTAAGTGTTAAAGCCACCTCAACAATTGATTGGACTTTTTCGTTTAATTT")

        results <- offTargetAnalysis(inputFilePath,         

            findgRNAsWithREcutOnly = TRUE,

              findPairedgRNAOnly = FALSE,

              annotatePaired = FALSE,

              scoring.method = "CFDscore",

              gRNAoutputName = "test",

              BSgenomeName = Hsapiens, chromToSearch = "chr6",

              txdb = TxDb.Hsapiens.UCSC.hg19.knownGene,

             orgAnn = org.Hs.egSYMBOL, max.mismatch = 2,

              outputDir = outputDir, overwrite = TRUE)

 

results$offtarget

 

      name             gRNAPlusPAM       OffTargetSequence inExon inIntron entrez_id gene    score n.mismatch

1 NA_gR23f CTGTTGACAAGTTGGTTTAANGG CTGTTGACAAGTTGGTTTGAGGG   TRUE               6908  TBP    0.375          1

2 NA_gR64f AAGCCACCTCAACAATTGATNGG AAGCCACCTCTATAATTGATTGG   TRUE               6908  TBP 0.215385          2

3 NA_gR57r AGTCCAATCAATTGTTGAGGNGG AGTCCAATCAATTATAGAGGTGG   TRUE               6908  TBP 0.681818          2

  mismatch.distance2PAM            alignment isCanonicalPAM            forViewInUCSC strand chrom chromStart  chromEnd

1                     2 ..................G.              1 chr6:170881636-170881658      +  chr6  170881636 170881658

2                  10,8 ..........T.T.......              1 chr6:170881677-170881699      +  chr6  170881677 170881699

3                   7,5 .............A.A....              1 chr6:170881680-170881702      -  chr6  170881680 170881702

                extendedSequence gRNAefficacy

1 ACTGCTGTTGACAAGTTGGTTTGAGGGAGA    0.1005271

2 GTTAAAGCCACCTCTATAATTGATTGGACT    0.2647941

3 AAAAAGTCCAATCAATTATAGAGGTGGCTT    0.3408939

                                                                                                                                                                                                                         

ADD REPLYlink modified 8 months ago • written 8 months ago by Julie Zhu3.8k

Thank you, Julie.  I found out the source of our problem - in our GFF file, the chromosome names were not in the form of chr1, chr2, ... etc.  After making the proper modifications, I was able to get the exon annotations. Thanks again for your help!

Joyce

ADD REPLYlink written 7 months ago by joyce0

Joyce,

Glad to help! Great that you found the cause of problem. Thanks for letting me know!

Best regards,

Julie

ADD REPLYlink written 7 months ago by Julie Zhu3.8k
0
gravatar for Julie Zhu
8 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:
Joyce, Thanks for the great question! Different applications place different emphasis on efficacy vs offTarget score. For example, in vitro screening assays are more interested in efficacy score, while therapeutic studies cannot tolerate even small offTarget effects. Therefore, it is very hard to come up with an equation to combine these two scores. Regarding exon annotation, it should be in the offTargets.xls file. If not, please post your session information using command sessionInfo(), a short test sequence, txdb and ss used in the code. Thanks! Best regards, Julie On Oct 22, 2017, at 2:46 PM, joyce [bioc] <noreply@bioconductor.org<mailto:noreply@bioconductor.org>> wrote: Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User joyce<https: support.bioconductor.org="" u="" 14189=""/> wrote Question: CRISPRseek CFD score<https: support.bioconductor.org="" p="" 101941=""/>: Hi Julie, I am using offTargetAnalysis function with CFD scoring method (CRISPRseek verison 1.16.0 from bioconductor) to select a few best-scoring gRNAs for each of a large set of sequences. In the past, I have used the combination of gRNAefficacy and top10OfftargetTotalScore in the summary file as criteria for selection. I wonder whether there are updated version of CRISPRseek that provides a single score that combine the gRNA efficacy and the off-target scores for each gRNA. On another note, in several recent jobs, I set annotateExon = TRUE, but I did not see any notation in either the "inExon" or the "inIntron" column in the OfftargetAnalysis.xls file. Did I miss something? The script I used is copied below: results=offTargetAnalysis("exon.fasta", findgRNAsWithREcutOnly = FALSE, annotateExon = TRUE, findPairedgRNAOnly = FALSE, exportAllgRNAs="fasta", txdb= txdb, max.mismatch = 3, BSgenomeName = ss, outputDir = ".", overwrite = TRUE, scoring.method="CFDscore") Thank you very much for your help! Joyce ________________________________ Post tags: crisprseek You may reply via email or visit CRISPRseek CFD score
ADD COMMENTlink written 8 months ago by Julie Zhu3.8k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 126 users visited in the last hour