r3cseq error with trimmed sequence as input
0
1
Entering edit mode
ch_el ▴ 10
@ch_el-22279
Last seen 2.7 years ago
Spain

Hello community, I am trying to run the r3cseq pipeline but errors are occuring in a specific situation. I did two tries, starting from a fastq file with a sequence of 50 bp, mapping to my genome(hg19), creating bams files and running the r3cseq pipeline. In that case I got results all the way to the end, plots etc. Then I did a second try, where I wanted to trim my sequence by 14 bp(so the new length is 36 bp),I did the mapping again, created bam files but then in the r3cseq pipeline I started getiing errors.

This is the code I used:

expFile <- "rawreads.bam"

my3Cseq.obj<-new("r3Cseq",organismName='hg19',isControlInvolved=F,alignedReadsBamExpFile=expFile,
                 viewpoint_chromosome='chr4',viewpoint_primer_forward='TTGCTTCTCATCTGTCGATC',
                 viewpoint_primer_reverse='CAGAAAGGTGAACCGAGAG',expLabel="label",
                 restrictionEnzyme='DpnII')

getRawReads(my3Cseq.obj)

getReadCountPerRestrictionFragment(my3Cseq.obj)

calculateRPM(my3Cseq.obj)

getInteractions(my3Cseq.obj)

expResults<- expInteractionRegions(my3Cseq.obj)

I am getting the error in the calculateRPM step:

Error in calculateRPM(my3Cseq.obj) : 
  No reads count per regions found in the r3Cseq object.

Is there a specific limit to the sequence length I can use?

I am also attaching part of my object's output:

Slot "expLibrarySize":
[1] 4794

Slot "contrLibrarySize":
integer(0)

Slot "expReadLength":
[1] 36

Slot "contrReadLength":
integer(0)

Slot "expRawData":
GRanges object with 4794 ranges and 0 metadata columns:
         seqnames              ranges strand
            <Rle>           <IRanges>  <Rle>
     [1]     chr4 121738162-121738197      +
     [2]     chr4 121738162-121738197      +
     [3]     chr4 121738162-121738197      +
     [4]     chr4 121738162-121738197      +
     [5]     chr4 121738162-121738197      +
     ...      ...                 ...    ...
  [4790]     chr4 121738162-121738197      +
  [4791]     chr4 121738162-121738197      +
  [4792]     chr4 121738162-121738197      +
  [4793]     chr4 121738162-121738197      +
  [4794]     chr4 121738162-121738197      +
  -------
  seqinfo: 1 sequence from an unspecified genome; no seqlengths

Slot "contrRawData":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "organismName":
[1] "hg19"

Slot "restrictionEnzyme":
[1] "DpnII"

Slot "viewpoint_chromosome":
[1] "chr4"

Slot "viewpoint_primer_forward":
[1] "ATAAAGTCATGTTCGTGATC"

Slot "viewpoint_primer_reverse":
[1] "CATGCATACTTTCATGCTTC"

Slot "expReadCount":
GRanges object with 0 ranges and 1 metadata column:
   seqnames    ranges strand |    nReads
      <Rle> <IRanges>  <Rle> | <integer>
  -------
  seqinfo: 24 sequences from an unspecified genome; no seqlengths

Slot "contrReadCount":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "expRPM":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "contrRPM":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "expInteractionRegions":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

Slot "contrInteractionRegions":
GRanges object with 0 ranges and 0 metadata columns:
   seqnames    ranges strand
      <Rle> <IRanges>  <Rle>
  -------
  seqinfo: no sequences

and my session info:

R version 3.6.3 (2020-02-29)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 18.04.4 LTS

Matrix products: default
BLAS:   /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.7.1
LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.7.1

Random number generation:
 RNG:     Mersenne-Twister 
 Normal:  Inversion 
 Sample:  Rounding 

locale:
 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=es_ES.UTF-8        LC_COLLATE=en_US.UTF-8    
 [5] LC_MONETARY=es_ES.UTF-8    LC_MESSAGES=en_US.UTF-8    LC_PAPER=es_ES.UTF-8       LC_NAME=C                 
 [9] LC_ADDRESS=C               LC_TELEPHONE=C             LC_MEASUREMENT=es_ES.UTF-8 LC_IDENTIFICATION=C       

attached base packages:
 [1] splines   parallel  stats4    stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
 [1] BSgenome.Hsapiens.UCSC.hg19.masked_1.3.99 BSgenome.Hsapiens.UCSC.hg19_1.4.0        
 [3] BSgenome_1.52.0                           r3Cseq_1.30.0                            
 [5] qvalue_2.16.0                             VGAM_1.1-2                               
 [7] rtracklayer_1.44.4                        Rsamtools_2.0.3                          
 [9] Biostrings_2.52.0                         XVector_0.24.0                           
[11] GenomicRanges_1.36.1                      GenomeInfoDb_1.20.0                      
[13] IRanges_2.18.3                            S4Vectors_0.22.1                         
[15] BiocGenerics_0.30.0                      

loaded via a namespace (and not attached):
 [1] Rcpp_1.0.4.6                lattice_0.20-41             assertthat_0.2.1            digest_0.6.25              
 [5] R6_2.4.1                    plyr_1.8.6                  chron_2.3-55                RSQLite_2.2.0              
 [9] sqldf_0.4-11                ggplot2_3.3.0               pillar_1.4.3                zlibbioc_1.30.0            
[13] rlang_0.4.5                 rstudioapi_0.11             data.table_1.12.8           blob_1.2.1                 
[17] rpart_4.1-15                Matrix_1.2-18               gsubfn_0.7                  proto_1.0.0                
[21] BiocParallel_1.18.1         stringr_1.4.0               RCurl_1.98-1.2              bit_1.1-15.2               
[25] munsell_0.5.0               DelayedArray_0.10.0         compiler_3.6.3              pkgconfig_2.0.3            
[29] tidyselect_1.0.0            SummarizedExperiment_1.14.1 tibble_3.0.1                GenomeInfoDbData_1.2.1     
[33] matrixStats_0.56.0          XML_3.99-0.3                crayon_1.3.4                dplyr_0.8.5                
[37] GenomicAlignments_1.20.1    bitops_1.0-6                grid_3.6.3                  gtable_0.3.0               
[41] lifecycle_0.2.0             DBI_1.1.0                   magrittr_1.5                scales_1.1.0               
[45] stringi_1.4.6               reshape2_1.4.4              ellipsis_0.3.0              vctrs_0.2.4                
[49] RColorBrewer_1.1-2          tools_3.6.3                 bit64_0.9-7                 Biobase_2.44.0             
[53] glue_1.4.0                  purrr_0.3.4                 yaml_2.2.1                  colorspace_1.4-1           
[57] memoise_1.1.0

Many thanks in advance!

r3cseq bam trimmed • 600 views
ADD COMMENT
0
Entering edit mode

I formatted your code by selecting each code chunk and pressing the '010101' button in the editor...

ADD REPLY

Login before adding your answer.

Traffic: 413 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6