Hii,
I have few questions
1) I am doing miRNA expression analysis. the experiment was done using mouse model. I am finding difficulty to do annotation. The chip used is miRNA_4.0.(affymetrix). I extracted the expression dataset. what should be done next to annotate.
2) I got
>featureData: none
Is this can be a problem
Thank you
We don't supply annotations for this array, because the Affy annotation file contains pretty much everything you need. The columns of that file are
"Probe Set ID" "Probe Set Name" "Accession" "Transcript ID(Array Design)" "Sequence Type" "Species Scientific Name" "Alignments" "Sequence Length" "Sequence" "Genome Context" "Clustered miRNAs within 10kb" "Target Genes" "GeneChip Array" "Annotation Date" "Sequence Source"
And the first few rows
"Probe Set ID","Probe Set Name","Accession","Transcript ID(Array Design)","Sequence Type","Species Scientific Name","Alignments","Sequence Length","Sequence" "20500000","MIMAT0000001_st","MIMAT0000001","cel-let-7-5p","miRNA","Caenorhabditis elegans","X:14744165-14744186 (-)","22","UGAGGUAGUAGGUUGUAUAGUU" "20500001","MIMAT0015091_st","MIMAT0015091","cel-let-7-3p","miRNA","Caenorhabditis elegans","X:14744123-14744147 (-)","25","UGAACUAUGCAAUUUUCUACCUUAC" "20500002","MIMAT0000002_st","MIMAT0000002","cel-lin-4-5p","miRNA","Caenorhabditis elegans","II:5902246-5902266 (+)","21","UCCCUGAGACCUCAAGUGUGA" "20500003","MIMAT0015092_st","MIMAT0015092","cel-lin-4-3p","miRNA","Caenorhabditis elegans","II:5902285-5902305 (+)","21","ACACCUGGGCUCUCCGGGUAC" "20500004","MIMAT0020301_st","MIMAT0020301","cel-miR-1-5p","miRNA","Caenorhabditis elegans","I:6172718-6172739 (-)","22","CAUACUUCCUUACAUGCCCAUA" You can read that in using
annot <- read.csv("miRNA-4_0-st-v1.annotations.20140513.csv", comment.char = "#")
Remember to ensure that your data and the annotation file are in the same order!
> eset
ExpressionSet (storageMode: lockedEnvironment)
assayData: 36353 features, 4 samples
element names: exprs
protocolData
rowNames: C1_(miRNA-4_0).CEL C2_(miRNA-4_0).CEL G1_5_(miRNA-4_0).CEL
G1_8_(miRNA-4_0).CEL
varLabels: exprs dates
varMetadata: labelDescription channel
phenoData
rowNames: C1_(miRNA-4_0).CEL C2_(miRNA-4_0).CEL G1_5_(miRNA-4_0).CEL
G1_8_(miRNA-4_0).CEL
varLabels: index
varMetadata: labelDescription channel
featureData: none
experimentData: use 'experimentData(object)'
Annotation: pd.mirna.4.0
even i loaded the cdf file for the experiment.
What is the probable mistake has happened. Is there any problem with cdf file installation.
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
version 2.3.6
Why do you think there is a problem?
Here the annotaion file seleted is : pd.mirna.4.0
I dont know whether it is the correct file. I installed the particluar cdf file. whether it should be the annotation file.
And how the miRNA annotation done ?? we can use getsymbol its for gene right
I dont know exactly what should be done because its the first time I am doing this.
Thank you in advance
You are analyzing miRNA data, not mRNA data. There are no gene symbols here, only mirBase names. In addition, as I have already told you, there is no annotation file from bioconductor that you can use. Look at my original post - there is a link there that you can use to get the annotation data from Affy, and some code you can use to read it in.
Presumably you are going to be making comparisons, and presumably you will be using the limma package, in which case you can add the annotation data to your MArrayLM object.
I understand that this is your first time, and everybody has to start somewhere. However, what you are doing is the equivalent of jumping off the high board into the deep end of the pool without even taking a single swimming lesson. Unless you think you can learn to swim on the way down, this is not the optimal way to begin.
If you are doing this analysis as practice, in order to learn, then you need to start reading. There are literally reams of information on the bioconductor site (for example here) that you can read, in order to figure out how to proceed, and to learn what you are doing.
If you are doing this analysis 'for real', then I highly recommend finding a local statistician with experience who can either do the analysis for you, or give you some mentoring.