TFBSTools and readFASTA
1
0
Entering edit mode
HELEN • 0
@ba287559
Last seen 9 weeks ago
Greece

Hello, i would like to find the trascription factors in my DNAsequences. These sequences are in FASTA format and they from the mouse. I have this code. But in subject i want to read the sequences from the fasta format with the readFASTA but i don't know how to do it. Thank you very much.

library(TFBSTools)
library(JASPAR2020)
library(Biostrings)
library(S4Vectors)

data(MA0003.2)
data(MA0004.1)
pwmList <- PWMatrixList(MA0003.2=toPWM(MA0003.2), MA0004.1=toPWM(MA0004.1),
                        use.names=TRUE)

subject <- DNAString("GAATTCTCTCTTGTTGTAGTCTCTTGACAAAATG")
SiteSetList <- searchSeq(pwmList, subject, seqname="seq1",
                         min.score="60%", strand="*")
head(writeGFF3(SiteSetList))
TFBSTools DNASeqData readFASTA DNA RStudio • 119 views
ADD COMMENT
0
Entering edit mode
@james-w-macdonald-5106
Last seen 2 days ago
United States

You should use readDNAStringSet to read in a FASTA file, as searchSeq expects a DNAStringSet.

Login before adding your answer.

Traffic: 295 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6