Search
Question: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

Sir, It is not working according to your guidance.

My location of exdata  folder is "C:\Users\SUSHOVAN\Documents\R\win-library\3.4\CRISPRseek\extdata" , where I have put two  similar fasta sequences X1.fa and X2.fa  I have tried to run the following code and got that error. The file fize of X1.fa and X2.fa is 1 Kb and 1Kb. variation among the sequences is about 10%-20%.

 

I cut and paste  from X1 and X2.fa to  the predefined , preexisting files rs362331C.fa  and rs362331T.fa

but same problem.

What is the meaning of   'x' has "out of limits" views

 

search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found
In addition: Warning messages:
1: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331C.fa-Aug-19-2017' already exists
2: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331T.fa-Aug-19-2017' already exists
> inputFile1Path <- system.file("extdata", "rs362331C.fa", package = "CRISPRseek")
> inputFile1Path <- system.file("extdata", "rs362331C.fa", package = "CRISPRseek")
> inputFile2Path <- system.file("extdata", "rs362331T.fa", package = "CRISPRseek")
> seqs <- compare2Sequences(inputFile1Path, inputFile2Path,outputDir = outputDir , REpatternFile = REpatternFile,overwrite = TRUE)
search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found
In addition: Warning messages:
1: In dir.create(outputDir) :
  'C:\Users\SUSHOVAN\Documents\rs362331C.fa-Aug-19-2017' already exists
2: In dir.create(outputDir) :

 

**************** Should I give very small sequence for comparing two sequence  with only 1SNP.

***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files).

Sir/Madam please help me 

ADD COMMENTlink modified 11 weeks ago • written 3 months ago by susobhanbaidya0
0
gravatar for Julie Zhu
3 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

Can you try these?

 readDNAStringSet(inputFile1Path)

 readDNAStringSet(inputFile2Path)

 

You should see your sequences. If not, then you need to make sure your files are in plain text format.

 

Alternatively, you can avoid storing input sequences in the file, and try to run the following code instead. Please replace the DNA sequences with your own two sequences.

inputFile1Path <- DNAStringSet("GACCCACGCCTGCTCCCTCATCTACTGTGTGCACTTCATCCTGGA")

names(inputFile1Path) <- "seq1"

inputFile2Path <- DNAStringSet("GACCCACGCCTGCTCCCTCATCCACTGTGTGCACTTCATCCTGGA")

names(inputFile2Path) <- "seq2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path,

    inputNames=c("Seq1", "Seq2"),

                scoring.method = "CFDscore",

        outputDir = getwd(), 
        overwrite = TRUE)

Best,

 

Julie

ADD COMMENTlink written 3 months ago by Julie Zhu3.8k

Thank u Julie, but

My question was about the length of the sequences and the difference between them.

Please see the the question

 

**************** Should I give very small sequence for comparing two sequence  with only 1SNP.

***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files).

ADD REPLYlink written 3 months ago by susobhanbaidya0
Please try with your entire sequences. Best, Julie On Aug 19, 2017, at 11:11 AM, susobhanbaidya [bioc] <noreply@bioconductor.org<mailto:noreply@bioconductor.org>> wrote: Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User susobhanbaidya<https: support.bioconductor.org="" u="" 13780=""/> wrote Comment: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working <https: support.bioconductor.org="" p="" 99429="" #99439=""> : Thank u Julie, but My question was about the length of the sequences and the difference between them. Please see the the question **************** Should I give very small sequence for comparing two sequence with only 1SNP. ***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files). ________________________________ Post tags: compilation error, filesize, bioconductor You may reply via email or visit C: 'x' has "out of limits" views ,Issue with the file size!! Compareequence functio
ADD REPLYlink written 3 months ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

Madam I tried to follow your suggestion , but same problem

*************** Should I give  small sequence for comparing two sequence  with only 1SNP.

***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files).

 

> inputFile1Path <- DNAStringSet("TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")
> names(inputFile1Path) <- "seq1"
> inputFile2Path <- DNAStringSet("TAATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCGAGCATCGCTATAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTCCCAGCCTCCACAGCATCGCGTTCCATGTCCCGGCGGAAGAGCTTCACAGGGCTCTCTAATGGAGCAGATTAGCTTTGTGGTAAACCGCTACACTGCTAACATCATCGAGCTTCATAGAATGAGGCTCACCACTTCTGCTCCAGGGGGAGCTGTCAGATTATCCACTATCACTTCAGCACACGTCCAATCACCTGTACGATGCTCTCCGCCATCTTACCGCCCGTCCCGGGAGGTTTCCCTACCTTCCACTATGACAACCTATGTTGAAATTCAACCACTCCGACCGGTGGAGTCAAACGTAGGTGGAGCAGCCACCTCCTGCCATCTTTGTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGCAATGAGCTATATGTGGGACTGGCAGCAGCTCTGGACTTGTCGTCCAATTAACCGGAGCTTGAGGAACTGCTGGCGCTGCCTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTATTTCCGAGCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA"
+ )
> names(inputFile2Path) <- "seq2"
> seqs <- compare2Sequences(inputFile1Path, inputFile2Path,inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",outputDir = getwd(), overwrite = TRUE)
search for gRNAs for input file1...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
search for gRNAs for input file2...
Validating input ...
Searching for gRNAs ...
<simpleError in fromXStringViewsToStringSet(x, out.of.limits = out.of.limits,     use.names = use.names): 'x' has "out of limits" views>
[1] "Scoring ..."
Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern,  : 
  object 'gRNAs1' not found

 

ADD COMMENTlink written 3 months ago by susobhanbaidya0
Susobhan, It seems that there is something special about your sequences. I need to figure out why these sequences cause the problem. It will take me some time. Will keep you informed. Best, Julie On Aug 19, 2017, at 1:21 PM, susobhanbaidya [bioc] <noreply@bioconductor.org<mailto:noreply@bioconductor.org>> wrote: Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User susobhanbaidya<https: support.bioconductor.org="" u="" 13780=""/> wrote Answer: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working <https: support.bioconductor.org="" p="" 99429="" #99444=""> : Madam I tried to follow your suggestion , but same problem *************** Should I give small sequence for comparing two sequence with only 1SNP. ***************** My input files were about 1Kb with 10-20 % variation (of nucleotide between those files). > inputFile1Path <- DNAStringSet("TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA") > names(inputFile1Path) <- "seq1" > inputFile2Path <- DNAStringSet("TAATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCGAGCATCGCTATAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTCCCAGCCTCCACAGCATCGCGTTCCATGTCCCGGCGGAAGAGCTTCACAGGGCTCTCTAATGGAGCAGATTAGCTTTGTGGTAAACCGCTACACTGCTAACATCATCGAGCTTCATAGAATGAGGCTCACCACTTCTGCTCCAGGGGGAGCTGTCAGATTATCCACTATCACTTCAGCACACGTCCAATCACCTGTACGATGCTCTCCGCCATCTTACCGCCCGTCCCGGGAGGTTTCCCTACCTTCCACTATGACAACCTATGTTGAAATTCAACCACTCCGACCGGTGGAGTCAAACGTAGGTGGAGCAGCCACCTCCTGCCATCTTTGTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGCAATGAGCTATATGTGGGACTGGCAGCAGCTCTGGACTTGTCGTCCAATTAACCGGAGCTTGAGGAACTGCTGGCGCTGCCTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTATTTCCGAGCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA" + ) > names(inputFile2Path) <- "seq2" > seqs <- compare2Sequences(inputFile1Path, inputFile2Path,inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",outputDir = getwd(), overwrite = TRUE) search for gRNAs for input file1... Validating input ... Searching for gRNAs ... <simpleerror in="" fromxstringviewstostringset(x,="" out.of.limits="out.of.limits," use.names="use.names):" 'x'="" has="" "out="" of="" limits"="" views=""> search for gRNAs for input file2... Validating input ... Searching for gRNAs ... <simpleerror in="" fromxstringviewstostringset(x,="" out.of.limits="out.of.limits," use.names="use.names):" 'x'="" has="" "out="" of="" limits"="" views=""> [1] "Scoring ..." Error in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : object 'gRNAs1' not found ________________________________ Post tags: compilation error, filesize, bioconductor You may reply via email or visit A: 'x' has "out of limits" views ,Issue with the file size!! Compareequence functio
ADD REPLYlink written 3 months ago by Julie Zhu3.8k

Yes Please help me Julie....

Those sequences has the length of 1kb base pair  and it has 10%-20% variation of bp between them.

Keenly waiting for your reply.

 

ADD REPLYlink modified 3 months ago • written 3 months ago by susobhanbaidya0
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

Thanks Julie for your enormous effort.

I have 2/ 3 precise question 

 

Qs1 > Can I compare more than 2 that is 3  sequences by any other command.

 

Qs2.  What is the meaning of Target in  sequence 1 one and Target in  sequence 2.

if in same xls file , we are getting  common GRNAs , then why two separate file.

 

QS3.

 

 What is significance of field A  in xls  (file2_gr7)

 

Qs4.  Can we get common  GRNAs from the given 2 input sequences. 

 

Last and very imnportant for me

 

 

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

 

I do not want  chromosome and spices specific data.

 

 

gRNAFilePath <- system.file('extdata', 'testHsap_GATA1_ex2_gRNA1.fa',

+ package = 'CRISPRseek')

> results <- offTargetAnalysis(inputFilePath = gRNAFilePath,

+ findgRNAsWithREcutOnly = FALSE, REpatternFile = REpatternFile,

+ findPairedgRNAOnly = FALSE, findgRNAs = FALSE,

+ BSgenomeName = Hsapiens, chromToSearch = 'chrX',

+ txdb = TxDb.Hsapiens.UCSC.hg19.knownGene,

+ orgAnn = org.Hs.egSYMBOL,

+ max.mismatch = 1, outputDir = outputDir, overwrite = TRUE)

ADD COMMENTlink modified 3 months ago • written 3 months ago by susobhanbaidya0
0
gravatar for Julie Zhu
3 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

Susobhan,

Qs1 > Can I compare more than 2 that is 3  sequences by any other command.

Yes, you need to perform 3 separate analysis, i.e., seq1 vs seq2 and seq3, seq2 vs seq1 and seq3, seq3 vs seq1 and seq2.

Qs2.  What is the meaning of Target in  sequence 1 one and Target in  sequence 2.

if in same xls file , we are getting  common GRNAs , then why two separate file.

Please type ?compare2Sequences for more detailed description.  For your convenience, here is the section relevant to you.

Value

Return a data frame with all potential gRNAs from both sequences. In addition, a tab delimited file scoresFor2InputSequences.xls is also saved in the outputDir, sorted by scoreDiff descending.

name

name of the gRNA

gRNAPlusPAM

gRNA plus PAM sequence

targetInSeq1

target/off-target sequence including PAM in the 1st input sequence file

targetInSeq2

target/off-target sequence incuding PAM in the 2nd input sequence file

guideAlignment2Offtarget

alignment of gRNA to the other input sequence (off-target sequence)

offTargetStrand

strand of the other sequence (off-target sequence) the gRNA align to

scoreForSeq1

score for the target sequence in the 1st input sequence file

scoreForSeq2

score for the target sequence in the 1st input sequence file

mismatch.distance2PAM

distances of mismatch to PAM, e.g., 14 means the mismatch is 14 bp away from PAM

n.mismatch

number of mismatches between the off-target and the gRNA

targetSeqName

the name of the input sequence where the target sequence is located

scoreDiff

scoreForSeq1 - scoreForSeq2

 

QS3.

 

 What is significance of field A  in xls  (file2_gr7)

 

See above (the name field)

 

Qs4.  Can we get common  GRNAs from the given 2 input sequences. 

Yes, scoreDiff = 0 will be the common ones (you only need to look at one of the output files I sent to you via email)

Last and very imnportant for me

 

 

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

Can you please clarify? Do you mean you are not interested in the genome-wide off-target analysis? 

I do not want  chromosome and spices specific data.

 

Best regards,

 

Julie

ADD COMMENTlink written 3 months ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

Thanks Julie again,

Your previous reply was

 

Susobhan,

Bioconductor recently transitioned from SVN to github. I need to set up account to clone my package, do testing and make changes if needed. It will take me quite sometime maybe days if I do have a big chunk of time to do this.

Therefore, I decied to send you some results for you to look at in case you are in a hurry. Please let me know if this makes sense.Here are the code I used to generate the outputfile.

inputFile1Path <- DNAStringSet("TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGATGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile1Path) <- "file1"

inputFile2Path <- DNAStringSet("TAATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCGACACTACAGCCAAAGCTCGTCTTCATTA")

 

names(inputFile2Path) <- "file2"

gRNAs1 <- findgRNAs(inputFile1Path, pairOutputFile ="testPair.xls", calculategRNAEfficacy = FALSE)

if (!file.exists("gRNAs4seq1"))

    dir.create(file.path(getwd(), "gRNAs4seq1"))

 compare2Sequences(gRNAs1, inputFile2Path, inputNames=c("Seq1", "Seq2"),findgRNAs = c(FALSE, TRUE), searchDir = "1to2",

scoring.method = "CFDscore",outputDir = "gRNAs4seq1", overwrite = TRUE)

 

gRNAs2 <- findgRNAs(inputFile2Path, pairOutputFile ="testPair.xls", calculategRNAEfficacy = FALSE)

 

if (!file.exists("gRNAs4seq2"))

    dir.create(file.path(getwd(), "gRNAs4seq2"))

 

 compare2Sequences(gRNAs2, inputFile1Path, inputNames=c("Seq2", "Seq1"),findgRNAs = c(FALSE, TRUE), searchDir = "1to2",

scoring.method = "CFDscore",outputDir = "gRNAs4seq2",  overwrite = TRUE)

 

 

Best,

 

Julie

Susobhan,

 

Bioconductor recently transitioned from SVN to github. I need to set up account to clone my package, do testing and make changes if needed. It will take me quite sometime maybe days if I do have a big chunk of time to do this.

 

Therefore, I decied to send you some results for you to look at in case you are in a hurry. Please let me know if this makes sense.

 

Here are the code I used to generate the outputfile.

 

**************************************************************************************************************************************

 

 

1. Yes then it is ok 

I need to run the above code to  compare  two large sequence.

But I am following the above code but it is not running.

Giving same error that I have mentioned . The out put u sent it will help me lots.

You told you need to change few package. 

Please  confirm me then if it is modified.

2. I want to get all potential off-target GRNAs from a single sequence.

Where, I do not want to mention any chromosome, species  etc.

Just input information will be Long Input genome sequence.

What will be the command in that case  

3. Julie, can you help me to clear the concept of Off target?

What i understood  from papers, materials that it is similar kind of pattern over the sequence, which is very complex to handle  genome edit. because it can be wrongly cleaved to another side.

 

 

 

ADD COMMENTlink written 3 months ago by susobhanbaidya0
0
gravatar for Julie Zhu
3 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

Susobhan,

Please try the following code, it should work and produce a file called scoresFor2InputSequences.xls in your output directory.

Please note that I removed one base at the beginning of your sequences. I need to fix the code in the github. However, I need wait for a day to be able to download CRISPRseek with read and write access. Will let you know once the package is updated. Meanwhile, the following approach should work (remove one base from the beginning of your sequences).

 

inputFile1Path <- DNAStringSet("AATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile1Path) <- "file1"

inputFile2Path <- DNAStringSet("AATATTTTAAAACCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTATCTCCTTTCACATTAAAAAGCGCGAAAGCAACCTGACAGCTGTGAACGAACCCTACTCAAAGACATCTGTTGGACGATACTGCGGCGGCAGTGACATAAACACGGACAAGTGCAACACCAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATTACCTACCTGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCGAGCATCGCTATAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTCCCAGCCTCCACAGCATCGCGTTCCATGTCCCGGCGGAAGAGCTTCACAGGGCTCTCTAATGGAGCAGATTAGCTTTGTGGTAAACCGCTACACTGCTAACATCATCGAGCTTCATAGAATGAGGCTCACCACTTCTGCTCCAGGGGGAGCTGTCAGATTATCCACTATCACTTCAGCACACGTCCAATCACCTGTACGATGCTCTCCGCCATCTTACCGCCCGTCCCGGGAGGTTTCCCTACCTTCCACTATGACAACCTATGTTGAAATTCAACCACTCCGACCGGTGGAGTCAAACGTAGGTGGAGCAGCCACCTCCTGCCATCTTTGTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGCAATGAGCTATATGTGGGACTGGCAGCAGCTCTGGACTTGTCGTCCAATTAACCGGAGCTTGAGGAACTGCTGGCGCTGCCTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTATTTCCGAGCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

names(inputFile2Path) <- "file2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",outputDir = getwd(), overwrite = TRUE)

I do not see use cases for #2. 

Offtargets here means sites, not intended for cut, might get cut.

 

Best regards,

 

Julie

 

ADD COMMENTlink written 3 months ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

Your reply was

Q5: what will be the commands for only  potential off target analysis of a given  input sequence only.

Not species specific 

Can you please clarify? Do you mean you are not interested in the genome-wide off-target analysis? 

Yes 

I want to get all potential off-target GRNAs from a single sequence.

Where,  Just input information will be Long Input genome sequence.

What will be the command in that case .

regards

Baidya 

ADD COMMENTlink written 3 months ago by susobhanbaidya0
0
gravatar for Julie Zhu
3 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

Baidya,

Please try the function compare2Sequences with

inputFile1Path and inputFile2Path containing the same sequence,  and set 
searchDirection = "1to2".

 

Best,

 

Julie

ADD COMMENTlink written 3 months ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
3 months ago by
susobhanbaidya0 wrote:

I cant get your answer, if you do not mind, can you please write complete code for that  example, 

I am very new with R.

Keenly waiting for your reply

ADD COMMENTlink written 3 months ago by susobhanbaidya0
0
gravatar for Julie Zhu
3 months ago by
Julie Zhu3.8k
United States
Julie Zhu3.8k wrote:

inputFile1Path <- DNAStringSet("AATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAGCGTCTCTCCTTTCACATCAAAAAGCGCGAAAGCAACCAGACGGCTGTGATCAAACCCTTCTCCAAGACATCTGAGGGACGCTACTGCGGAGGCAGCGACATAAACACGGACAACAGCAACAACAAGATGCTCTATGAAGTCACGGAGGCGGAGGAACGCTACCCAATCACCTACCGGCCCCAAACGCCCTCTCCAATCAGCACCGTCACACAAAGAGCTAGCATCGCTTTAGCACAAAGCTCTGACGCGCAGGTCATGAGTGTTTCTACGTACATGTGCCAGCCTCCACAGCATCGCGTGCCATGTCCTGGCGGAAGCGCGTCACAGGGCTCTCTAATGGAGCAGATTAGCTGTGTGGTAAACCGCTTCACTGCTAACATCAGCGAGCTTAATAGCATGATGCTCACCAGTTCTCCTCCAGGGGGAGCTGTCGGTTTATCCACTAGCACTTCAGCACACGTCCACTCACCTGAACCATGCTGTCCACCATCTTACCGCCTGTCCCGGGAGGTTTCCCTACCATCCACTATGACAACCTATGCTGAAATACAGCCACTCCCACCGGTGGAGTCAAACGTGGGTCGAGCTGCCACCTCCTGCCATCTTTCTGGACCATCACGACTGAAAACATCTCCAACAACCAGTGGGAATGAGCTAAAAGTGGGAGTGGCATCAGCTCTGGAGTCGCCGTCCAATCAACCGGAGCTTGAGGAACTGCTGGCGCTGACTCCGCCCTCCCCCTTTAGGGACTCGGTTGGGTCAGGCAGCGCTTCACCCAGTTCTCCAACATCCGATGCTGAAACTTCAGTACTTCCGACCATCCCTAAATACGAGTGCCTGGTGCTGCGACACTACAGCCAAAGCTCGTCTTCATTA")

inputFile2Path <- inputFile1Path

names(inputFile1Path) <- "file1"

names(inputFile2Path) <- "file2"

seqs <- compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"),scoring.method = "CFDscore",

searchDirection = "1to2", outputDir = getwd(), overwrite = TRUE)

 

I think you will benefit greatly from learning some basics about R.

 

Best,

 

Julie

ADD COMMENTlink written 3 months ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
12 weeks ago by
susobhanbaidya0 wrote:

Thank you julie,

Can you tell me, in the column of F in xls sheet sgrna efficiency means what?

What is the scoring mechanism ( Doench Activity score or Efficiency score )

ADD COMMENTlink modified 12 weeks ago • written 12 weeks ago by susobhanbaidya0
Baidya, I gave a workshop at Bioc2017 in Boston last month. Please refer page 8 of the slides at https://www.bioconductor.org/help/course-materials/2017/BioC2017/Day1/Workshops/CRISPR/CRISPRseek-GUIDEseq-Bioc2017-forPosting.pdf. BTW, the code has been enhanced to work with your sequences on the development version of CRISPRseek (1.7.3). I re-analyzed your two input sequences and please find attached the updated results. Best regards, Julie From: "susobhanbaidya [bioc]" <noreply@bioconductor.org> Reply-To: "reply+8f49d4c4+code@bioconductor.org" <reply+8f49d4c4+code@bioconductor.org> Date: Friday, August 25, 2017 at 11:00 AM To: "Zhu, Lihua (Julie)" <julie.zhu@umassmed.edu> Subject: [bioc] A: 'x' has "out of limits" views , Issue with the file size!! Compareequence functio Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User susobhanbaidya<https: support.bioconductor.org="" u="" 13780=""/> wrote Answer: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working <https: support.bioconductor.org="" p="" 99429="" #99728=""> : Thank you julie, Can you tell me, in the column of F in xls sheet sgrna efficiency means what? What is the scoring mechanism ________________________________ Post tags: compilation error, filesize, bioconductor You may reply via email or visit A: 'x' has "out of limits" views ,Issue with the file size!! Compareequence functio
ADD REPLYlink written 12 weeks ago by Julie Zhu3.8k
0
gravatar for susobhanbaidya
12 weeks ago by
susobhanbaidya0 wrote:

 

Yes I got your attached file.

Thank you Julie.

I understood Score difference Zero means Common GRNA.

Q1. But Score Difference One means what ?

Q2. Still I want to know the formula of sgRNA efficiency score which is fractional. 

How it is coming.

Q3. High Score means what ? is it stable sgRNA chunk to be edited by CRISPR CAS9?

Is it calculated by  DOENCH ACTIVITY SCORE.

I read your Workshop pdf.

There it is not  mentioned 

 

 

ADD COMMENTlink written 12 weeks ago by susobhanbaidya0
Q1. But Score Difference One means what ? Score difference of 1 means that the gRNA is unique to one of the two sequences, Q2. Still I want to know the formula of sgRNA efficiency score which is fractional. The paper has the details. 1. Doench et al., 2014 Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038 nbt.3026 Q3. High Score means what ? is it stable sgRNA chunk to be edited by CRISPR CAS9? Is it calculated by DOENCH ACTIVITY SCORE? Yes (the reference is on slide 8) Best, Julie From: "susobhanbaidya [bioc]" <noreply@bioconductor.org> Reply-To: "reply+60d492b5+code@bioconductor.org" <reply+60d492b5+code@bioconductor.org> Date: Friday, August 25, 2017 at 12:35 PM To: "Zhu, Lihua (Julie)" <julie.zhu@umassmed.edu> Subject: [bioc] A: 'x' has "out of limits" views , Issue with the file size!! Compareequence functio Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User susobhanbaidya<https: support.bioconductor.org="" u="" 13780=""/> wrote Answer: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working <https: support.bioconductor.org="" p="" 99429="" #99732=""> : Yes I got your attached file. Thank you Julie. I understood Score difference Zero means Common GRNA. Q1. But Score Difference One means what ? Q2. Still I want to know the formula of sgRNA efficiency score which is fractional. How it is coming. Q3. High Score means what ? is it stable sgRNA chunk to be edited by CRISPR CAS9? Is it calculated by DOENCH ACTIVITY SCORE. I read your Workshop pdf. There it is not mentioned ________________________________ Post tags: compilation error, filesize, bioconductor You may reply via email or visit A: 'x' has "out of limits" views ,Issue with the file size!! Compareequence functio
ADD REPLYlink written 12 weeks ago by Julie Zhu3.8k

hanks Julie, 

Can you please tell me about  the the off target region.

I mean to say.  suppose the location is 1000 for a frame of 20bp in the sequence. Now what will be the region of consideration for the off target analysis.

As far my knowledge it should be plus/minus 500bp at max.

That means I have to consider the locus from 500bp to 1500bp  to find out any potential of target for the frame at location 1000.

If I am wrong please guide me. 

ADD REPLYlink written 11 weeks ago by susobhanbaidya0
Please start a new thread with a relevant title so that others can find it easily. I suggest use "CRISPRSEEK package compare2Sequences function offTarget region" as the title . Best, Julie On Aug 29, 2017, at 6:49 AM, susobhanbaidya [bioc] <noreply@bioconductor.org<mailto:noreply@bioconductor.org>> wrote: Activity on a post you are following on support.bioconductor.org<https: support.bioconductor.org=""> User susobhanbaidya<https: support.bioconductor.org="" u="" 13780=""/> wrote Comment: 'x' has "out of limits" views ,Issue with the file size!! Compareequence function is not working <https: support.bioconductor.org="" p="" 99429="" #99791=""> : hanks Julie, Can you please tell me about the the off target region. I mean to say. suppose the location is 1000 for a frame of 20bp in the sequence. Now what will be the region of consideration for the off target analysis. As far my knowledge it should be plus/minus 500bp at max. That means I have to consider the locus from 500bp to 1500bp to find out any potential of target for the frame at location 1000. If I am wrong please guide me. ________________________________ Post tags: compilation error, filesize, bioconductor You may reply via email or visit C: 'x' has "out of limits" views ,Issue with the file size!! Compareequence functio
ADD REPLYlink written 11 weeks ago by Julie Zhu3.8k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.2.0
Traffic: 186 users visited in the last hour