Error in GenomeInfoDb:::makeNewSeqnames
Entering edit mode
Last seen 6 months ago
University of Salerno, Salerno, Italy

Hello Bioc, I'm trying to work with ggbio to plot some "mismatch proportion plot"
(my goal is to make a proportion plot but for a specific position, but someone has to start from somewhere),
the code is from this vignette on page 22-23.
I am not sure why there is the issue about the seqlevels() as the bam file is made using STAR,
with an index of Genome sequence, primary assembly (GRCh38) So the seqlevels should be : "chr1", "chr2", "chr3" ...
Let me know if there is a need to upload part of the bam file also.

Thank you for your time. Konstantinos


bg <- BSgenome.Hsapiens.UCSC.hg38
# import the bam
my_bam <- "my_bam.featureCounts.bam"
Rsamtools::indexBam(my_bam )

p.mis <- autoplot(my_bam , 
                  bsgenome = bg, 
                  which = wh, 
                  stat = "mismatch")
reading in as Bamfile
Error in GenomeInfoDb:::makeNewSeqnames(x, new2old = new2old, seqlevels(value)) : 
  when 'new2old' is NULL, the first elements in the
  supplied 'seqlevels' must be identical to 'seqlevels(x)'

sessionInfo( )
R Under development (unstable) (2021-01-07 r79806)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu 20.04.1 LTS

Matrix products: default
BLAS/LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/

 [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C               LC_TIME=en_US.UTF-8       
 [4] LC_COLLATE=en_US.UTF-8     LC_MONETARY=en_US.UTF-8    LC_MESSAGES=C             
 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                  LC_ADDRESS=C              

attached base packages:
 [1] splines   stats4    parallel  stats     graphics  grDevices utils     datasets 
 [9] methods   base     

other attached packages:
 [1] ggbio_1.39.0                      BSgenome.Hsapiens.UCSC.hg38_1.4.3
 [3] BSgenome_1.59.2                   rtracklayer_1.51.3               
 [5] Biostrings_2.59.2                 XVector_0.31.1                   
 [7] RColorBrewer_1.1-2                pheatmap_1.0.12                  
 [9] rafalib_1.0.0                     NOISeq_2.35.0                    
[11] Matrix_1.3-2                      Biobase_2.51.0                   
[13] edgeR_3.33.0                      limma_3.47.3                     
[15] tximport_1.19.1                   plyranges_1.11.0                 
[17] GenomicRanges_1.43.1              GenomeInfoDb_1.27.3              
[19] IRanges_2.25.6                    S4Vectors_0.29.6                 
[21] BiocGenerics_0.37.0               data.table_1.13.6                
[23] forcats_0.5.0                     stringr_1.4.0                    
[25] dplyr_1.0.2                       purrr_0.3.4                      
[27] readr_1.4.0                       tidyr_1.1.2                      
[29] tibble_3.0.4                      ggplot2_3.3.3                    
[31] tidyverse_1.3.0                   BiocManager_1.30.10              

loaded via a namespace (and not attached):
  [1] readxl_1.3.1                backports_1.2.1            
  [3] Hmisc_4.4-2                 aroma.light_3.21.0         
  [5] BiocFileCache_1.15.1        plyr_1.8.6                 
  [7] lazyeval_0.2.2              BiocParallel_1.25.2        
  [9] digest_0.6.27               ensembldb_2.15.1           
 [11] htmltools_0.5.0             fansi_0.4.1                
 [13] checkmate_2.0.0             magrittr_2.0.1             
 [15] memoise_1.1.0               cluster_2.1.0              
 [17] modelr_0.1.8                matrixStats_0.57.0         
 [19] R.utils_2.10.1              vroom_1.3.2                
 [21] askpass_1.1                 prettyunits_1.1.1          
 [23] jpeg_0.1-8.1                colorspace_2.0-0           
 [25] blob_1.2.1                  rvest_0.3.6                
 [27] rappdirs_0.3.1              haven_2.3.1                
 [29] xfun_0.20                   crayon_1.3.4               
 [31] RCurl_1.98-1.2              jsonlite_1.7.2             
 [33] graph_1.69.0                VariantAnnotation_1.37.1   
 [35] survival_3.2-7              glue_1.4.2                 
 [37] gtable_0.3.0                zlibbioc_1.37.0            
 [39] DelayedArray_0.17.7         scales_1.1.1               
 [41] DBI_1.1.0                   GGally_2.1.0               
 [43] Rcpp_1.0.5                  htmlTable_2.1.0            
 [45] progress_1.2.2              foreign_0.8-81             
 [47] bit_4.0.4                   OrganismDbi_1.33.0         
 [49] Formula_1.2-4               htmlwidgets_1.5.3          
 [51] httr_1.4.2                  ellipsis_0.3.1             
 [53] reshape_0.8.8               pkgconfig_2.0.3            
 [55] XML_3.99-0.5                R.methodsS3_1.8.1          
 [57] nnet_7.3-14                 dbplyr_2.0.0               
 [59] locfit_1.5-9.4              utf8_1.1.4                 
 [61] reshape2_1.4.4              tidyselect_1.1.0           
 [63] rlang_0.4.10                AnnotationDbi_1.53.0       
 [65] munsell_0.5.0               cellranger_1.1.0           
 [67] tools_4.1.0                 cli_2.2.0                  
 [69] generics_0.1.0              RSQLite_2.2.2              
 [71] broom_0.7.3                 evaluate_0.14              
 [73] yaml_2.2.1                  knitr_1.30                 
 [75] bit64_4.0.5                 fs_1.5.0                   
 [77] AnnotationFilter_1.15.0     RBGL_1.67.0                
 [79] EDASeq_2.25.0               R.oo_1.24.0                
 [81] xml2_1.3.2                  biomaRt_2.47.1             
 [83] compiler_4.1.0              rstudioapi_0.13            
 [85] filelock_1.0.2              curl_4.3                   
 [87] png_0.1-7                   reprex_0.3.0               
 [89] stringi_1.5.3               GenomicFeatures_1.43.3     
 [91] lattice_0.20-41             ProtGenerics_1.23.6        
 [93] vctrs_0.3.6                 pillar_1.4.7               
 [95] lifecycle_0.2.0             bitops_1.0-6               
 [97] R6_2.5.0                    BiocIO_1.1.2               
 [99] latticeExtra_0.6-29         hwriter_1.3.2              
[101] ShortRead_1.49.1            gridExtra_2.3              
[103] dichromat_2.0-0             assertthat_0.2.1           
[105] SummarizedExperiment_1.21.1 openssl_1.4.3              
[107] rjson_0.2.20                withr_2.3.0                
[109] GenomicAlignments_1.27.2    Rsamtools_2.7.0            
[111] GenomeInfoDbData_1.2.4      hms_0.5.3                  
[113] rpart_4.1-15                grid_4.1.0                 
[115] rmarkdown_2.6               MatrixGenerics_1.3.0       
[117] biovizBase_1.39.0           base64enc_0.1-3            
[119] lubridate_1.7.9.2           tinytex_0.28               
[121] restfulr_0.0.13
GenomeInfoDb ggbio • 489 views
Entering edit mode
Last seen 3 hours ago
United States

If you aligned to an Ensembl based genome, then your chromosomes will NOT start with 'chr'. Instead they will be 1-22, X, Y, MT

Entering edit mode

Dear James,

I checked my bam file:

samtools view my_bam.featureCounts.bam | head
NS500352:257:HMMK7BGX7:1:22205:15792:5903   272 chr1    10003   0   41M *   0   0   ACCCTAAACCTAACCCTAACCCTAACCCTAACCCTAACCCT   EE/EA<///EE//AEAAAEEEEEAAEEEAE/EEE6/AAAA/   NH:i:36 HI:i:13 NM:i:1  MD:Z:7C33   XS:Z:Unassigned_NoFeatures
NS500352:257:HMMK7BGX7:1:22205:15792:5903   272 chr1    10009   0   41M *   0   0   ACCCTAAACCTAACCCTAACCCTAACCCTAACCCTAACCCT   EE/EA<///EE//AEAAAEEEEEAAEEEAE/EEE6/AAAA/   NH:i:36 HI:i:12 NM:i:1  MD:Z:7C33   XS:Z:Unassigned_NoFeatures
NS500352:257:HMMK7BGX7:1:22205:15792:5903   272 chr1    10015   0   41M *   0   0   ACCCTAAACCTAACCCTAACCCTAACCCTAACCCTAACCCT   EE/EA<///EE//AEAAAEEEEEAAEEEAE/EEE6/AAAA/   NH:i:36 HI:i:11 NM:i:1  MD:Z:7C33   XS:Z:Unassigned_NoFeatures

if I'm not missing something, the names of the chromosomes start with "chr".


Login before adding your answer.

Traffic: 237 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6