<div class="preformatted">
Hello,
Â
I am learning edgeR and would like to use it dealing with my Tag-seq
and RNA-seq data. I have several questions:
Â
1. Does the DE analysisÂ...div class="preformatted">
Hello,
Â
I am learning edgeR and would like to use it dealing with my Tag-seq
and RNA-seq data. I have several questions:
Â
1. Does the DE...abo…
Order by: Relevance
<div class="preformatted">Hi,
I was hoping someone would be able to provide me with some general
advice on using EdgeR for some sRNA datasets I have received.
I have 3 sRNA datasets, and I have calculated all abundances (just
read counts) of...<div class="preformatted">Hi,
I was hoping someone would be able to provide me with some general
advice on using EdgeR for some sRNA dataset…
updated 11.1 years ago • Kenlee Nakasugi
i have RNA seq counts data when i apply TMM normalization why do i also get negative values beside positive one my source code is below:
library(edgeR)
RNAseq2 <-read.delim("C:\\\\Users\\\\hp folio\\\\Desktop\\\\BRCA.tsv",header = TRUE)
rnames <-RNAseq2\[,1\]
MA <- data.matrix(RNAseq2\[,2...why do i also get negative values beside positive one my sour…
updated 5.9 years ago • marak
<div class="preformatted">Dear edgeR users
If you are using the release version of edgeR, please ensure you have
updated to the latest release version, edgeR 2.2.5. We caught a bug in
exactTest() introduced in v2.2.0 that affects p-values when some rows
of the count matrix are all zeros.
A recent off-list question prompted me to remind everyone of this bug-
fix on the list.
Ideally all B…
nbsp; I´m using R 3.2.2 and trying to install edgeR package. ´m getting a warning, it says it is not available in R 3.2.2. Somebody knows how can I get edgeR by using this version
updated 8.9 years ago • glorobame
Bioconductor mailing list <bioconductor@r-project.org>
Sent: Wednesday, May 22, 2013 4:53 PM
Subject: edgeR MDS
Dear Manoj,
plotMDS does not do PCA. As the documentation says
"This function is a variation on the usual multdimensional...0700 (PDT)
> To: "Bioconductor@r-project.org" <bioconductor@r-project.org>
> Subject: [BioC] edgeR MDS
>
> He…
CPM) and log2(CPM) as follow:
> CPM <- cpm(x)
> logCPM <- cpm(x, log=TRUE, prior.count = 1)
The CPM matrix looks as expected but the logCPM returns negative values, and with a prior.count=1.0 I would expect
scale and asked me if there is a way to get the values on the positive scale.
Then, I increased `prior.count` (started increasing from +150 --> + 250), the minimum values increase to positive value scale. Meaning the log negative...values now transformed to the positive values. However, I am not sure if adding larger prior.count value would affect downstream analysis like differential ana…
updated 15 months ago • Sabiha
div class="preformatted">Hi all,
I have a question concerning the normalization factors in
edgeR. I
think that if we know which genes are none-DE genes in advance, we
could
calculate "true" normalization factors based...on those information.
Given
"true normalization factors", edgeR could find more right DE genes, or
even
find all the right DE genes when the simulation is simple.
…
updated 10.1 years ago • Zhan Tianyu
div class="preformatted">Hi,
Is the program for edgeR used for miRNA?
Lana Schaffer
Biostatistics, Informatics
DNA Array Core Facility
858-784-2263
[[alternative HTML version
previous releases of all Biconductor packages,
see:
http://bioconductor.org/checkResults
To run edgeR 2.4.6 you need to install R 2.14.2 (available from
www.r-project.org), and then install edgeR using biocLite() in the
usual...way. You will automatically get edgeR 2.4.6. In fact, you will get
the
version of any package that was part of Bioconductor release 2.9.
If you want to run edgeR..…
<div class="preformatted">I have 4 large tag datasets A1, A2 and B1, B2. The purpose of the
experiment was to determine differences in gene expression between A
and B.
A1 and B1 were done together as batch 1, and A2 and B2 were done
together as batch 2.
I several analyses and am completely puzzled.
First I ran sage.test (Fisher's exact test) on A1, B1 and on A2,
B2. The results were s…
All,
I have RNA-seq data for different time points 0hr,2hr,4hr,6hrs and
8hrs.
I would like to use edgeR to get genes that are differentially
expressed
throughout the experiment.
In a recent edgeR user's manual ,it has been
users.
Here
are the steps:
- dource(http://bioconductor.org/biocLite.R")
- biocLite()
- biocLite('edgeR')
The first steps can be executed without any problem but the
biocLite('edgeR') command causes a lot of errors (below are the...In function `R_exact_test_by_deviance':
/scratch/pennings/tmp/Rtmp5LmotH/R.INSTALL22017e509b8c/edgeR/src/R_exa
ct_test_by_deviance.cpp:19:
undefined reference to `Rf…
<div class="preformatted">Dear edgeR maintainers,
I have some troubles setting up the correct design for my DE
experiment. I now how my experiment design should...div class="preformatted">Dear edgeR maintainers,
I have some troubles setting up the correct design for my DE
experiment. I now how my experiment design...the subjects with each
other. But when i run my analysis function whic…
div class="preformatted">Dear Alll,
I'm reading edgeR manual and i would appreciate if anyone can tell me
what
is the default normalization method of CalcNormFactors function
updated 12.7 years ago • chris Jhon
div class="preformatted">Hi all,
I have used edgeR to analyse my Illumina RNAseq data. It generally
works fine and I get biologically meaningfull DGE results.
I appreciate...what value
is used to plot these tags on the logFC-Axis.
I have not been able to find this in the edgeR-manual or Mark
Robinson's /Davis McCarthy's paper. Any ideas on this would be
appreciated!
Best,
martin
_________…
<div class="preformatted">I'm dealing with a factorial RNA-seq data set in which cells have been
stimulated with various combinations of extra-cellular cues. As such,
I was interested in applying the GLM framework in edgeR to assess the
contribution of each extra-cellular cue to the differential expression
of certain genes. My concern, however, is that both the expression
level and the disp…
<div class="preformatted">Dear List
I have been using the glmFit method in edgeR to analyse some RNA-Seq
data. I will soon be presenting this data to a more statistically
naive audience (and I'm no expert myself) and I was hoping to be able
to prepapre a figure demonstrating how this particular edgeR analysis
approach works.
Basically what I'd like to do would be to plot count data for on…
div class="preformatted">I am relatively new to R and EdgeR.
In the similar package DEseq, there is the possibility of analyzing a
dataset containing replicates only for one condition...condition with replicates is considered to
compute the dispersion.
In the part of the User Guide of EdgeR regarding "working without
duplicates" this is not mentioned.
I am asking if something similar is possib…
genes that are differentially expressed
throughout
the time points in these 2 genotype of trees with edgeR. I read from
the
edgeR user guide, the suitable DE analysis method for my expriment is
GLM
likelihood ratio test.
After...read the user guide, I have the RNA-Seq counts in a file like
below
in order to input into the edgeR package:
Ref Tags H1_C H2_C H1_3H H2_3H H1_1D H2_1D H1_2D H2_2D L1_…
Hi there,
I am analysing my sequencing data with edgeR and limma packages. I was looking for the DEGs in fetal muscle as a result of a maternal stress treatment during gestation...y,method = "TMM")
#Transformations from the raw-scale
logCPM <- cpm(y, log=TRUE, prior.count=2)
#Random effect correlation with Litter as a random effect
design <- model.matrix(~0+Treatment+Se…
updated 4.3 years ago • weichengz
<div class="preformatted">I am working with edgeR to look at differential expression in a 2x2
design
of two populations with two treatments (a total of 4 groups with 6
replicates...div class="preformatted">I am working with edgeR to look at differential expression in a 2x2
design
of two populations with two treatments (a total of 4 groups with 6...each). I have very interesting results.…
that are differentially expressed (DE)
throughout the time points in these 2 genotype of trees with edgeR. I
read
from the edgeR user guide, the suitable DE analysis method for my
expriment
is GLM likelihood ratio test.
After...study in the user guide, I have the RNA-Seq counts in
a
file as below in order to input into the edgeR package.
Ref Tags H1_C H2_C H1_3H H2_3H H1_1D H2_1D H1_2D H2_2D L1…
and roast.
Btw.
voom(), camera() and roast() are still part of limma but just referred
to
in the edgeR manual (they can be used also with other packages).
Best Regards, Pekka
2013/6/24 <julie.leonard@syngenta.com>
> I see that...the new version of edgeR has roast and camera
implemented. Is
> there a plan to implement romer in edgeR as well?
>
> Thanks!
&g…
div class="preformatted">
Hi edgeR expert:
I got a problem in using edgeR for RNA Seq data analysis. The
manual recommends the use of getPriorN to get an appropriate...estimation formula
prior.n * df = 20 ~ 30 where df = #of samples - #of conditions, it
seems that the edgeR package will never work for sample size > 15 for
two conditions if 30 is used in the formula, and > 11…
I am new to using R and my project is on differential gene expression
.I
was told to use Edger but I am having trouble reading a tab delimited
format data for affy oligonucleotide microarray data .
How can I read
updated 12.0 years ago • Shravanthi P
div class="preformatted">dear all:
i have non-strand specific RNA-seq samples for
edgeR analysis.
first, i used bowtie to map my reads to the
assembled contigs to count the sample. then for each
contig, i got two...the
other is reverse count.
if i sum these two number together to get one
count number for edgeR input. is it right?
should i sum them or average them
--
s…
div class="preformatted">Hi, all
I am a newbie to EdgeR. Now, I am following the introduction to EdgeR,
and I need the training data set of Zhang, W et al. 1997. The link in
the original
<div class="preformatted">Dear edgeR and R community,
Good day.
I'm using the edgeR to analysis my RNA-Seq data which contained 2
genotype (HS,LS) and different time points (0H, 3H, 24H, 96H). The
differential analysis was carried out based on the guide of the latest
edgeR user's guide (Chapter 3, section 3.3).
May I ask it that common to obtain the summary of differentially
express (DE)…
data and I would like to join the expression
values
for the replicas of the different treatments in edgeR. I would like to
plot
some figures with the combined information of my replicas, as I have
found
some confusing results...when they are plotted invidually. Is there a
way to
do this in edgeR or maybe I could compute the mean expression value of
samples over treatments and pass this matrix to …
Hi,
I will be really grateful if someone answer me:
Is it possible to make online search with edgeR from databases like
Coriell Institute?
For example I have an ID of a read like: NA06985 and I want to check
whether this...is a read from a male or female sample. How can I do this
search automatically with edgeR?
-- output of sessionInfo():
no commands
--
Sent via the guest posting facility at…
div class="preformatted">Hi,
I'm using EdgeR to analyse a proteomic data with peptide counting. I
have
limited experience on R/EdgeR/Statistics so I appreciate some
div class="preformatted">hello....
i am trying ti find out differential gene by the edgeR package.i have
2
transcriptome libraries, one is control and other is experimental.
when i estimate overall dispersion...466 563
4 contig00004 610 98
5 contig00005 72 21
6 contig00006 82 2
> library(edgeR)
> y <- DGEList(counts=rawdata[,2:3], genes=rawdata[,1:1])
Calcula…
div class="preformatted">Dear all,
I would appreciate a suggestion about edgeR : I have a GRO-seq dataset
(CTL
vs TREAT, no replicates, just 1 sample for CTL and 1 sample for TREAT
condition),
and I am assessing...the differential expression by using edgeR, but I
am
getting an error : any suggestion would be appreciated. thanks very
much !
> d <- estimateCommonDisp(d)
Warning
Hello,
I'm trying to return to a previous version of edgeR (3.26.1). I had been using edgeR 3.26.1 and R 3.6.0 within a bioinformatics pipeline implemented on a supercomputing...After a change in the system, I had to reinstall the pipeline along with a new installation of edgeR and R, which defaulted to edgeR 3.32.1 and R 4.0.3. Processing the same set of data with the new edgeR/R installatio…
updated 3.0 years ago • mvanhorn
div class="preformatted">
I want to use edgeR to detect differential expression. For this I
first read the bam file with this function:
getCounts <- function(alignmentName...polyMin=polyMinCounts)
Then I follow the tutorial from:
http://cgrlucb.wikispaces.com/edgeR+Tutorial
So to build the edgeR object, I have this code:
y <- DGEList(counts=rawCountTable, group=groups)
y &l…
Dear Anders,
Thanks for the bug report and the reproducible example. The problem
is
fixed in edgeR 1.5.4.
Note that you could also specify the contrast by pair=c(1,3) instead
of
c("A","C").
Best wishes
Gordon
> library(edgeR)
>...library( edgeR )
> counts <- matrix( rnbinom( 600, 5, .1 ), ncol=6 )
> conds <- c( "A", "A", "B", "B", "C", "C" )
> …
re not missing anything obvious I think. In R for Windows,
there's a
drop-down menu item for the edgeR User's Guide. In Unix or Mac,
however,
the easiest way is following the html package help starting from
help.start(), and...So I've just now committed through a new function
edgeRUsersGuide()
to the release version of edgeR, which will work just like the
corresponding function in limma. …
<div class="preformatted">Hello,
My name is Tonya and I am very new to both R and edgeR so
sorry if this seems silly. I have recently gotten back
results of two samples from a 454 and do not have
replicates of...div class="preformatted">Hello,
My name is Tonya and I am very new to both R and edgeR so
sorry if this seems silly. I have recently gotten back
results of two samples from a…
<div class="preformatted">Can i associated trait into edgeR result? I have quantitative traits
such as height in each library that would like to find gene that co-
regulate or co-expression...div class="preformatted">Can i associated trait into edgeR result? I have quantitative traits
such as height in each library that would like to find gene that co-
regulate or co...with that trait. H…
div class="preformatted">Dear list,
I am using edgeR to analyze a RNA-Seq dataset consisting of 4 samples
(groups), each with 5 biological replicates.
I have read in the Limma...there is a description for multiple
groups
test, and I have tried to follow the steps there. But the edgeR
objects are
distinct from the Limma, so I am stucked.
Shortly, I want to use edgeR to identify differential …
div class="preformatted">I am a beginner of everything of R and edgeR; just like "copy and
paste of the command" of the manual.
I tried to make DGEList object like descriptions on page 9.
I could...0
AAACAGCAGTGTTCTGAAGCCAAACTC 0
....
I use R for Mac OSX GUI 1.35 and newest edgeR.
I am very happy, if you have any comments.
Thank you.
Takuya
</div
<div class="preformatted">I have a reasonable RNASeq data set of 10 biological replicates of a
control group versus 10 biological replicates experimental I've gone
through the edgeR workflow, and get a nice list of about 1000 genes
differentially expressed due to the experimental manipulation. I input...replicates of a
control group versus 10 biological replicates experimental I've gone
thr…
<div class="preformatted">Dear list,
when I run the same code for RNA-seq data to find differentially
expressed genes using exactTest() in two different versions of edgeR,
I
obtain considerable different results. The data set contains 36
libraries divided into 12 groups, where each library is consist of 24
000 genes (none of them has all zero counts). While the older version
(edgeR_2.0.5) …
over five time points and I
have been looking for software that handles such situations. I hoped
edgeR would provide me with the the tool and that the edgeR Users
Guide would contain coded examples. Alas, I cannot find anything
List,
I'm just starting with R and wanted to analyze my data for
differential
expression using edgeR. Here is the code which is working for me but I
want
to check if I'm missing something as I get more number of
differentially...99
CR1 and CR2 are replicates of controls and MR1 and MR2 are treated
sample
replicates
library(edgeR)
library(limma)
raw.data <- read.delim("RNAseq-MycReadCoun…
<div class="preformatted">Hi Everyone,
I have been using edgeR for the last couple years with great success.
Thanks very much. Now I have slightly unconventional dataset to try.
We
have...div class="preformatted">Hi Everyone,
I have been using edgeR for the last couple years with great success.
Thanks very much. Now I have slightly unconventional dataset to try.
We...This library would
i…
div class="preformatted">Dear List,
I am getting few errors while running edgeR and would like to know few
things too as i am novice to edgeR and R. My errors and questions are
as follows:
1. I am getting an...error "could not find function plotBCV". As i am
loading package edgeR and limma, I shouldn't be getting this error. So
why i am getting this error?
2. plot smear also doesn't seem to wo…
updated 12.4 years ago • Javerjung Sandhu
read the section on normalization in the edgeR User's Guide.
Best wishes
Gordon
> Date: Mon, 10 Feb 2014 11:06:31 -0800 (PST)
> From: "Yanzhu [guest]" <guest at="" bioconductor.org...gt; To: bioconductor at r-project.org, mlinyzh at gmail.com
> Subject: [BioC] EdgeR norm.factor input
>
>
> Dear Gordon,
>
> Thank you so much for your com…
updated 10.6 years ago • Guest User
div class="preformatted">Hi EdgeR community:
I'm reading the edgeR
manual<http: bioc="" doc="" edg="" edgerusersguide.pdf="" er="" inst="" packages="" release="" vignettes="" www.bioconductor.org
<div class="preformatted">Dear all,
I am a novice edgeR user.
The edgeR manual describes the steps to produce an maPlot from 2
groups of samples, page 5/58 in:
http://bioconductor.org/packages/release/bioc/vignettes/edgeR/inst/doc
/edgeR.pdf
par(mfrow = c(1, 2))
maPlot(D[, 1], D[, 2], normalize = TRUE, pch = 19, cex = 0.2, ylim =
c(-8, 8))
grid(col = "blue")
abline(h = log2(f[2]), col = …
<div class="preformatted">
Recently, I use edgeR in R to find DEG, When I loaded my data and
estimated the dispersion with estimateCommonDisp, there are always
some warnings for my data:
estimateCommonDisp(y,verbose=TRUE)
Disp = 99.99477 , BCV = 9.9997
There were 50 or more warnings (use warnings() to see the first 50)
warnings()
Warning messages:
1: In condLogLikDerSize(y, r, der = 0L) : v…
div class="preformatted">Hello edgeR patrons,
I have RNA-seq data for multiple samples with biological replicates, I
want
to look at the goodness of fit for...fitting Poisson and NB models used by edgeR for common, trended and
tag-wise dispersion. Does setting dispersion=0
in glmFit use the Poisson model? Also I am using...the following code to
generate and compare qqplots for the models(figu…
<div class="preformatted">Dear Maria,
Are you simply asking how to join sequencing libraries together?
If you have two matrices of counts (with the same number of rows
representing the same genes or transcripts in the same order), then
you
can join them together using cbind:
counts <- cbind(counts1, counts2)
Then make your DGEList as usual:
d <- DGEList(counts=count…
updated 10.5 years ago • Gordon Smyth
div class="preformatted">Hi All,
I used calcNormFactors function in edgeR to normalize my data :
Normalized->calcNormFactors(data)
However ,when i used it
Normalized1->calcNormFactors(data
updated 12.4 years ago • chris Jhon
div class="preformatted">Dear edgeR Community,
I have 12 samples that belong to two groups (A and B), 6 samples per
group,
and I want to know which genes are up-regulated
library
has detected my use of a dynamically loaded .so, and has reverted to
serial
behavior? Or is edgeR preventing it's functions from being fork'ed
somehow?
Thanks in advance,
-Aaron
[[alternative HTML version deleted]]
</div
morning all,
I am just starting to analyse my first set of RNA-seq results and am
trying to use EdgeR to do this. I have spent time reading the vignette
and manual and working through it using our data. The design of our
experiment...the contrasts we expect (i.e. there is no "Ap" or "France") and I
think that this might be because EdgeR is using the first level of the
factors of Genotype and Lea…
Recent ...
Replies
Comment: How to use removeBatchEffect for removing effect of multiple confounding variabl
by
James W. MacDonald
67k
Please don't add questions onto a four-year old post. Instead, start a new one. If you want to reference the old post, that's fine.
Answer: How to use removeBatchEffect for removing effect of multiple confounding variabl
by
bioinformata
•
0
Is it feasible to remove batch effect with limma after variance stabilizing transformation of the gene expression , or is eough to use vst…
Comment: clusterProfiler: BgRatio N value does not match the size of the gene universe th
by
James W. MacDonald
67k
Hi Guido,
It's that last filtering step. You are saying the NCBI Gene ID has to be unique AND the ontology has to be BP, which isn't what …
Comment: AffylmGUI does not start wit R 4.4.1
by
richardallenfriedmanbrooklyn
▴
20
Gordon,
I found out what went wrong. The problem was that the xquartz distribution for mac from cran did not include tcltk! I found that b…
Comment: clusterProfiler: BgRatio N value does not match the size of the gene universe th
by
Guido Hooiveld
★
4.1k
Hi James,
I am likely missing something obvious, but why is the code that I used returning a different number of genes having a GOALL-BP a…
Votes
Awards
• All
Popular Question to
Gordon Smyth
51k
Popular Question to
Dario Strbenac
★
1.5k
Popular Question to
rae.alshammari
▴
10
Popular Question to
Mthabisi Moyo
▴
40
Popular Question to
peris_baba
•
0
Locations
• All
United States, 1 minute ago
France, 2 minutes ago
Canada, 5 minutes ago
United States, 9 minutes ago
United States, 10 minutes ago
United States, 1 minute ago
France, 2 minutes ago
Canada, 5 minutes ago
United States, 9 minutes ago
United States, 10 minutes ago
Traffic: 755 users visited in the last hour
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by the
version 2.3.6
version 2.3.6