Bioconductor Forum

class="preformatted">By trial-and-error it seems the attribute "hgnc_symbol" yields a unique gene identifier ... but I am not quite sure. Instead a variable numbers of " refseq_dna" values are listed for the same "hgnc_symbol". In...short, given the "ensembl_gene_id" (ENSGxxxxxxxxxxx), is it possible to get the gene identifier for which this is a transcript ? Thank you so much, Maura tutti …

updated 15.8 years ago • mauede@alice.it

Neurl4 86485 ENSMUST00000147800 Slc26a9</pre> tximport doesn't recognized the versioned identifiers in quant.sf   <pre> > txi.salmon <- tximport(quant_files, type="salmon", tx2gene=tx2gene) reading

tximport ensembldb

updated 7.5 years ago • Ed Siefker

preformatted">I forgot to specify that I am only dealing with Human species. I used the ENSGxxxxx identifier to get out some data that I hoped would uniquely identify the gene. > gene.map <- getBM(attributes=c("hgnc_symbol...values="ENSG00000206557",mart=hmart) > show(gene.map) As long as all Human genes are uniquely identified through their respective "hgnc_symbol" I a…

miRNA miRNA

updated 15.8 years ago • mauede@alice.it

Wondering whether there already a tried and tested solution in R to deal with the issue of mistaken identifiers [Zeeberg et al. (2004) Mistaken Identifiers: Gene name errors can be introduced inadvertently when using Excel...to be often looked at using MS Excel. Thank you. Cheers, Chintanu [[alternative HTML version deleted]] </div

updated 12.4 years ago • Chintanu

class="preformatted">Dear all, Currently, I'm comparing the gene expression of three cell types to identify differentially expressed genes. For this purpose, the limma package seems ideal. However, for one of the analyses...about 990 genes. Is this enough to perform an analysis with limma, or does it require a larger number of genes at minimum to give reliable results? Kind regards, Bas van …

Transcription limma Transcription limma

updated 10.9 years ago • Bas van Gestel

I have series of Salmon quant.sf files that include Ensembl gene and transcript IDs with version number. For example: ```r tibble::tribble( ~ensembl_tx, ~ensembl_gene, "ENST00000456328.2", "ENSG00000223972.5", "ENST00000450305.2...for example `EnsDb.Hsapiens.v86`. However Ensembl IDs in `EnsDb.Hsapiens.v86` do not include any version numbers, e.g.: ```r library(Ens…

AnnotationDbi ensembldb

updated 4.2 years ago • Ezgi

I would like to identify the regions with repeated patterns in a given genome. Let's say that I need to identify \[TA\]n regions, were 'n' is a variable...number of repeats. I thought in a loop to resolve the problem, however, it will take a long time and will produce redundant regions

biostrings

updated 8.6 years ago • Vinicius Henrique da Silva

my samples. And I compare cellranger 2.0 and cellranger 3.0 for the same sample and found the cells number are quite different. The expect cells for me is 6000 cells, cellranger 2.0 think there are 3442 cells , while cellranger...3.0 think there are 10275 cells. I think the version 2.0 are too less while version 3.0 too more, so I want to use DropletUtils Package to identify real cells compare to…

single-cell 10X Cell calling DropletUtils cellranger

updated 6.1 years ago • xingxd16

Hi again! This time I am trying to figure out how can I determine if I have obtained optimal number of clusters using the buildSNNgraph and igraph approach. I can increase and decrease the resolution of clusters...changing parameter *k* which I know is the number of neighbors and not the number of centroids. I recently read a method paper, [IKAP][1], that is based on `Seurat` object and...…

scran gap statistics single cell clustering

updated 5.0 years ago • p.joshi

I am running biomaRt version 2.35.11 and I get a scan error when I try to access the most current version of a dataset using a version number (version...91). Removing the version accesses the latest dataset, but is it possible to indicate the latest version so that running the code in the future...dataset? <pre> > mart_obj <- useEnsembl(biomart="ensembl", dataset='mmusculus…

biomart rstudio ensembl mart

updated 7.1 years ago • mullpaul

When specifying the current version of Ensembl (97) to the biomaRt package in the same way that you would specify the archive version I’m getting the following...fails. I should note that this does not occur on my work computer which has a slightly older version of R installed via conda, but does happen on my personal computer which has the latest version of R installed directly...lt;- "97" …

biomart

updated 5.8 years ago • Anthony Castanza

<div class="preformatted">I am staring at the miRNAs and mature miRNAs FASTA files I downloaded from one of the BioMart database The file format is as follows: >hsa-miR-26a MIMAT0000082 Homo sapiens miR-26a UUCAAGUAAUCCAGGAUAGGCU >hsa-miR-26b MIMAT0000082 Homo sapiens miR-26b UUCAAGUAAUUCAGGAUAGGU >hsa-miR-27a MIMAT0000084 Homo sapiens miR-27a UUCACAGUGGCUAAGUUCCGC &am…

miRNA Homo sapiens biomaRt miRNA Homo sapiens biomaRt

updated 15.8 years ago • mauede@alice.it

Hi all, I am using fastMMN for batch correction and subsequently buildSNNGraph and cluster\_walktrap for clustering on single-cell rna seq data on multiple samples. However, I end up with way higher number of clusters compared to what I would expect. By setting the steps parameter in cluster\_walktrap it is possible to change...for clustering on single-cell rna seq data on multiple samples. Howe…

scran buildsnngraph cluster_walktrap single-cell

updated 6.7 years ago • tobi

file which I downloaded from UCSC and the second one is the 10kbp promoter file for mouse (mm10). I Identified the number of repetitive sequences by repeat Family (repFamily) in 10kbp promoter region in mouse.I used GRanges...I am looking for help using the previous functions or any other functions in GRanges package to identify the repetitive sequences based on total base pairs for each repeat

granges short tandem repetitions repeat

updated 8.2 years ago • mkmb2004

an RNAseq experiment. What is not clear to me is on what basis to chose `m1` which is the "expected number of prognostic genes". Is it the number of significant genes I identified in my own dataset? For the example below, the power...estimation by read count and dispersion distribution est_power_distribution( n = 20, # Number of samples in each group m = 12, # Total num…

RnaSeqSampleSize

updated 3.8 years ago • Matthias Munz

div class="preformatted">Dear Group What the most convenient direct way of identifying sets of correlated genes ? Thanks a lot Alyaa -- Alyaa Mahmoud "Love all, trust a few, do wrong to none"- Shakespeare [[alternative...HTML version deleted]] </div

updated 12.4 years ago • Alyaa Mahmoud

But, now, we are in a position to have biological replicates. But, we are trying to decide the number. I understand more is merrier. But, what is a good number? If that is too vaguge to suggest a number....we plan for 4 biological...Is that good enough ? Couple more information on the project: 1) Aim of the project is to identify mRNAs that are bound to one translational factor (compared to anot…

RNASeq Organism edgeR RNASeq Organism edgeR

updated 12.9 years ago • gowtham

between two conditions across different cell types in a single-cell dataset. It appears that the number of features (genes) detected changes from one cell type to another, with some cell types having up to 5-6 times more features...than others. I assume this will have an impact on identifying significant gene regulation events, as p-value correction for multiple testing (both BH or Bonferroni) …

edgeR DESeq2 single-cell scRNAseq zinbwave

updated 3.9 years ago • vincent.croset

div class="preformatted"> Dear Bioconductor users, i have RefSeq gene descriptions and also UniProt identifiers. How can i map this onto KO numbers (KEGG Orthology), e.g. K03120 ? </div

updated 15.0 years ago • Alla Bulashevska

Hi, I have a question concerning the exon identifiers that are used in quasR for the exon counts.I use a GTF file to create a transcript DB: <pre> gtfFile <- file.path...Hi, I have a question concerning the exon identifiers that are used in quasR for the exon counts.I use a GTF file to create a transcript DB: <pre> gtfFile <- file.path(project.dir...the quantificat…

rnaseq exon quasr

updated 10.4 years ago • sven.schuierer

of my research interest, the data I am planning to work on is qPCR data, with much smaller number of genes (from around 30 genes), with relatively big sample size (1000 samples, highly heterogeneous). Apparently...I could not get scale free topology, and identifying any big module, which I think is because of the small number of genes. I looked up a lot but could not find anyone…

WGCNA

updated 8.2 years ago • zson3366

drop-down you see "Release\_3\_5", "Release\_3\_6", etc. which don't correspond at all to PureCN versions, which all start with "1.", so I'm wondering how to interpret those? How would I determine the PureCN version number of the...latest version on the release branch in the repository (without cloning the repository, building it, loading it, and looking at the...version number

version PureCN

updated 5.4 years ago • twtoal

Hello! I want to use DESeq2 to identify genes that are differentially expressed across 10 genotypes ranked by restoration value (resval). However, I want...the numbers to be seen as numerical, not categorical, as the rank order matters. Currently, my code is set up like this. ``` dds<-DESeqDataSetFromMatrix...9] "resval_9_vs_1" "resval_10_vs_1" Which indicates to me that DESeq…

DESeq2

updated 3 months ago • natalievillafranca

div class="preformatted">Dear list members: Once I know a KEGG pathway identifier, how can I check all its direct children identifiers? you know, I could use GOMFCHILDREN or GOCCCHILDREN to check

GO GO

updated 17.9 years ago • Li, Hua

div class="preformatted">Hi all, I'd like to use limma to identify a possible interaction between two drugs (called "x" and "y") which would be reflected in gene expression. That is, each...0 0 control -1 -1 -1 [[alternative HTML version deleted]] </div

limma limma

updated 16.0 years ago • Suzanne Szak

Is there a way to map Uniprot names (e.g. RASH\_HUMAN) to other identifiers using Bioconductor? I have tried biomaRt, the AnnotationDbi-based packages and uniprot.ws, but all seem to need...accession accession numbers. I had more hope with uniprot.ws since it is possible to do this conversion from the uniprot web site itself

uniprot.ws

updated 4.1 years ago • Diego Diez

Hi, I have a question about using lfcshrink() vs results() to identify DEGs. I'm currently identifying upregulated DEGs as having padj<0.01 and log2FC>1. Using unshrunken results...DEGs come from genes with low counts, so if I apply lfcshrink() and use these shrunken log2FC to identify DEGs, I end up with around 400 DEGs. It seems like lfcshrink() is used for ranking DEGs, ca…

DESeq2 lfcshrink

updated 2.5 years ago • Zainab

I'm looking at.  I would like to generate a random control list of genes that has the same number of genes and approximately the same coding length as my gene list of interest.  Is there anything in bioconductor...that can do this.  The basic question is:  "Is the number of variants identified by NGS in our sample set greater in our gene list of intere…

random generator gene list

updated 6.9 years ago • paul.hillman

<div class="preformatted">Dear list, Context : I'd like to calculate GO enrichments for a list of UniProt identifiers (note that they are "ID" or "Entry name" and NOT "AC" or "Accession"). So I tried to use BioMart to extract the GO-IDs for my list...preformatted">Dear list, Context : I'd like to calculate GO enrichments for a list of UniProt identifiers (note that they are "ID" or "En…

GO biomaRt GO biomaRt

updated 14.0 years ago • Wolfgang RAFFELSBERGER

separately. (This was only introduced in a later version of the perl script). The --offline flag does not seem to be available in variant_effect_predictor.pl version 2.5, at...plugin [plugin_name] Use named plugin module [default: off] --hgnc Add HGNC gene identifiers to output [default: off] --hgvs Output HGVS identifiers (coding and protein). Requires database …

Transcription HapMap PolyPhen SIFT convert genomes ensemblVEP Transcription HapMap SIFT

updated 11.3 years ago • Thomas Sandmann

class="preformatted">Hi All i have a object gp = c(1,2,3,4,21,22,23,24,38,39) and i want to count number of groups containing consecutive numbers as ans should be three as group1 (1,2,3,4), group2 (21,22,23,24) and group3 contains...38,39) any suggestions [[alternative HTML version deleted]] </div

updated 14.7 years ago • ALok

Dear all, I've been trying to use cn.mops to identify copy number variants among 10 individual of my (non-human) study species. Each individual was subjected to Illumina...Dear all, I've been trying to use cn.mops to identify copy number variants among 10 individual of my (non-human) study species. Each individual was subjected to Illumina whole-genome sequencing, and the reads were mapped to t…

cn.mops

updated 8.1 years ago • rc16955

I am trying to convert GenBank accession numbers to Entrez ID or Symbol using the org.Hs.egACCNUM object. However many of the GenBank accnum in my list do not exist...in the object. The description of this object says: “This object is a simple mapping of Entrez Gene identifiers https://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db=gene to all possible GenBank accession numbers”. For example...k \[…

org.hs.eg.db bioconductor

updated 8.2 years ago • colaneri

Hi all : - I found that the DropletUtils has been developed from 1.2.2 to 1.3.10 so quickly , whats the new feature in the new version. I found that the barcodeRanks function results can not get only by "$", its has a attribute called "metadata". What else new...DropletUtils has been developed from 1.2.2 to 1.3.10 so quickly , whats the new feature in the new version. I found that the barcode…

DropletUtils Bioconductor singel cell

updated 6.1 years ago • xingxd16

div class="preformatted">Dear all, I would like to identify gene expression markers from gene expression profilings using Bayesian. Does anybody know whether there is any...in keeping with good practice, ensure that they are actually virus free. ArraDx Ltd. Registration Number NI 43067 Registered Address : Almac House, 20 Seagoe Industrial Estate, Craigavon, BT63 5QD</div

Bayesian Bayesian

updated 20.6 years ago • Liu, Xin

div class="preformatted">Hi , I would like to get some inputs on analyzing copy number variants for a case control study. I have never worked with copy number variants before and I was wondering if there...are any R packages out there for analyzing copy number variants data and to get me started. I do have cell files from Affymetrix for my cases and controls. I appreciate your...inputs and h…

updated 15.0 years ago • Kay Jaja

<div class="preformatted">Hi, I am quite new to the limma package and I would like to know how there is a possibility to get the link between the gpr file entries and the used identifiers. In the header it says there is no gal file and in the xls file there seems to be a completely different order. Is there...like to know how there is a possibility to get the link between the gpr file entr…

limma limma

updated 16.2 years ago • Gunter Neumann

downloaded the illuminaHumanv2ProbeID.db package and want to plot some genes on chromosomes. But the identifiers used in this packages are not the same with the annotation file provided by GEO database. The latter use TARGET...ID(ex, GI-****). Could you please tell me what are the identifiers preferred in the illuminaHumanv2ProbeID.db package? And HOW could I change those TARGET ID used by GEO d…

Annotation Annotation

updated 16.9 years ago • YANG Ling

use a lumi expression set with the PGSEA package and GO to generate genesets. I understand that the identifiers used in the data matrix need to be the same as those used in the genesets. Therefore, since I am using the GO database...I need to use the ENTREZ identifiers for my matrix. How can I go about doing this? Obviously I cannot have multiple rows with the same name so I will have

GO lumi PGSEA GO lumi PGSEA

updated 16.8 years ago • Sebastien Gerega

div class="preformatted"> Dear all, Is there any way to get all entrez identifiers that are annotated with KEGG pathways? Actually I am using GOStats package in R to perform KEGG pathway enrichment...In general, for each KEGG pathway term there is a list of annotated hgnc symbols or entrez identifiers.. For all KEGG pathway terms we must have one list of entrez identifiers. I want to have tha…

GOstats GOstats

updated 12.1 years ago • Guest User

Hi! I have a question about using the Limma package, lmfit() and ebayes in R which I was hoping someone could answer. Briefly, I want to use the Limma package and the eBayes fit and BH p.value adjust method to be able to identify differences in DNA copy number values for a particular gene between ovarian cancer cell lines which have a mutated or normal copy of another gene (for example is there…

R limma

updated 10.2 years ago • djtml

newdata=as.matrix(data[,3:ncol(data)]))' Now the output data has no "X" or "Y" values and the row numbers start at 660693. What is the standard method for keeping a unique identifier for each row name throughout the vsn algorithm

vsn PROcess xps vsn PROcess xps

updated 11.1 years ago • Matthew Thornton

Hi, I would like to find the number of disjunct occurrences of a motif set (e.g. 3 motifs) in a given StringSet. This basically means the sequences shall...Hi, I would like to find the number of disjunct occurrences of a motif set (e.g. 3 motifs) in a given StringSet. This basically means the sequences shall be walked from left to right and looked up for matches of the motif set. If one …

Biostrings patternmatch

updated 3.1 years ago • Stefanie Tauber

I'd like to get an up-to-date list of all the bioconductor packages together with their version number for a particular BioC version. I know all\_group() will return the list of package names, but I also need the versions

packages

updated 9.1 years ago • nathan.watsonhaigh

class="preformatted">Dear List Is there currently any package (or way) allowing to associate KEGG K numbers (K02995) to pathways (ko03011) or ec. numbers? Thanks, Fabian ! [[alternative HTML version deleted]] </div

Pathways Pathways

updated 14.7 years ago • Fabian Grammes

moe430a and rae230a annotation packages, and have just noticed that in the current release(moe430a version 1.8.5 and rae230a version 1.8.4) the ACCNUM mappings correspond to the GenBank accession numbers from the 'Representative...Public Identifier' field of the Affymetrix csv format annotation files, whereas in the 3 previous releases (moe430a and rae230a...versions 1.5.1, 1.6.5 and 1.7.0) the A…

Annotation moe430a rae230a Annotation moe430a rae230a

updated 19.8 years ago • MARIA STALTERI

<div class="preformatted">Dear all, I have a data set consisted of 4 cell types with each cell type having 3 replicates. I find the unique signature genes of each cell types using decideTests (see following). I only want the top, say 20 signature probes that satisfy my thresholds. I tried to use "number=20" as for the "topTable" function with "decideTests", but it gave me the an error (se…

updated 13.9 years ago • Wendy Qiao

Hello all, I have a question regarding the cnetplot from the clusterprofiler package in R. As shown in the first figure, the number of nodes appear in my cnetplot is too many that many data points (genes) are unlabeled. It seems that all genes in my gene list that belong to a certain category appear in the plot regardless of their FC values. Is there any way that I can reduce the number…

cnetplot R clusterProfiler

updated 2.2 years ago • YNKIM

div class="preformatted">Hi Raj, In addition to aroma, there's also copy number estimation in crlmm and a hidden Markov model in VanillaICE that incorporates log R ratios and BAFs. Rob On Mar 17, 2012...16, 2012 5:36 PM > To: bioconductor@r-project.org; drrajan22@yahoo.com > Subject: [BioC] Copy number analysis > > > Dear Bioconductor community, > …

SNP affy VanillaICE SNP affy VanillaICE

updated 13.1 years ago • Rob Scharpf

Hi, For the Affy 6.0 platform, I would like to know the default tool for obtaining copy number estimates prior to smoothing across loci (raw copy number). If CNAT is the default, is there a command-line version of this

affy affy

updated 16.7 years ago • Rob Scharpf

set in Ensembl using biomaRt functions A key info I have no idea how to get , though, is the miRNA identifier (for example "hsa-miR-647"). I wonder whether there is an attribute that extract exactly such info from Ensembl .... is...you) is to generate a text files containing > a list of Homo-Sapiens validated miRNAs (microRNA-identifier, sequence) > and relative 3'UTR regions (gene-…

miRNA Homo sapiens biomaRt miRNA Homo sapiens biomaRt

updated 15.8 years ago • mauede@alice.it

Dear Bioconductors, I have a long list of dbSNP identifiers (e.g. `` rs7335199 ``), some of which are outdated and now represented by a new identifier. For example, the following call...My goal is to retrieve the genome coordinates (GRCh38) and, if available, the current variant identifier for millions of variants. So far, I have tried 1. ensembl's REST service: great for smaller queries, bu…

variants variantannotation SNPlocs.Hsapiens.dbSNP150.GRCh38 biomaRt

updated 7.1 years ago • sandmann.t

I have transformed, normalized and batch effect corrected RNA-seq count dataset and I want to identify the Differentially expressed genes I have noticed that many workflows\packages to identifying Differentially

identifyingDifferentiallyexpressedgenes DESeq2

updated 4.2 years ago • MOHAMMAD

div class="preformatted">Dear all, I would like to identify gene expression markers from gene expression profilings using Bayesian. Does anybody know whether there is any...in keeping with good practice, ensure that they are actually virus free. ArraDx Ltd. Registration Number NI 43067 Registered Address : Almac House, 20 Seagoe Industrial Estate, Craigavon, BT63 5QD</div

Bayesian Bayesian

updated 20.6 years ago • Liu, Xin

Hi, I used to be able to get Ensembl version numbers from non-vertebrate marts, but sometime between Ensembl 81 and 84 this has been lost.  For instance, vertebrate...marts clearly show their version numbers: > listMarts(host="www.ensembl.org")                         …

biomart ensembl

updated 8.9 years ago • arielpaulson

with SGD Gene identifiers org.Sc.sgdENSEMBLPROT Map Ensembl protein acession numbers with SGD Gene identifiers org.Sc.sgdENSEMBLTRANS...Map Ensembl transcript acession numbers with SGD Gene identifiers org.Sc.sgdENTREZID Map Systematic ORF identifiers with Entrez Gene identifiers org.Sc.sgdENZYME...Mappings between ORF identifiers and KEGG pathway identifiers org.Sc.sgdPMID Map be…

org.Sc.sgd.db

updated 17 months ago • Chih

<div class="preformatted">Hello All I am using GSE4137 for identifying differentaily gene expression analysis. For annotation i am using the platform annotation file provided by...div class="preformatted">Hello All I am using GSE4137 for identifying differentaily gene expression analysis. For annotation i am using the platform annotation file provided...the vendor alongside their micro…

Microarray Annotation probe convert Microarray Annotation probe convert

updated 13.3 years ago • Reema Singh

A collaborator, using the same dataset, was able to run vsn successfully using an earlier version of R (2.9.0) and Bioconductor (version ?). Is anyone familiar with this problem? I see two ways forward: 1, Find the appropriate...old) version of Bioconductor and analyze with the original controls. 2. Use the current R/Bioconductor releases and either find...patient (with a total 853 patients…

Normalization vsn Normalization vsn

updated 15.1 years ago • Eric E. Snyder

div class="preformatted">Hi Bioconductors, Download numbers for Bioconductor Software packages are online at: http://bioconductor.org/packages/stats/ There is no by-version or

Cancer Cancer

updated 16.4 years ago • Hervé Pagès

and want to use DESeq2 to normalize the counts. However, I used Picrust to correct the 16S copy number for OTUs and the number generated by this correction are not integers (but decimals). Can I used DESeq2 to normalized...my count data (using size factor) obtained by this 16S number correction considering that the DESeq2 was developed based in counts and not in counts corrected by 16S copy numbe…

DESeq2 DESeq2

updated 11.0 years ago • Manoeli Lupatini