Bioconductor Forum

list(promoter=proms,enhancer=SE)) interaction_track <- InteractionTrack(interactions,name='HiC',chromosome = chr) displayPars(interaction_track) <- list(col.interactions="lightblue", col.interactions.types...col.interactions.types=c(is.pd='red')) with not success. I'm not sure what names in the named vector are recognized. A…

GenomicInteractions gviz

updated 5.9 years ago • Marco Blanchette

so much for sharing your example and excellent solution! Yes, if you create your RangedData with names field, then the sequences will have names associated with, that are used by write2FASTA as sequence headers. In the future...could be automatically generated if no head found. Here is the example to create a RangedData with names field filled in. peaks = RangedData(IRanges(start=c(100, 500), …

GO BSgenome BSgenome GO BSgenome BSgenome

updated 15.4 years ago • Julie Zhu

see below) reproducible report. The bottomline is that R's read.table does not like newline (\n) characters within quoted text ("), interpretes them as line ends, which messes up the tab-delimited table that the BioMart query...two possible solutions: - The BioMart dataset is modified to abstain from putting \n and other funny characters within quoted text - the biomaRt package is modified to to…

biomaRt biomaRt

updated 14.8 years ago • Wolfgang Huber

has anyone been able to handle EPIC and EPICv2 together. ```r > ?CNV.create_anno ... array_type: character. One of '450k', 'EPIC', 'EPICv2', 'mouse'. When analyzing data from multiple array types, choose between 'overlap.1' for 450k...in CNV.create_anno(array_type = "overlap.2", exclude_regions = exclude_regions, : array_type must be one/multiple of 450k, EPIC, EPI…

conumee CopyNumberVariation MethylationArrayData

updated 10 months ago • Adam

beadSD ) This code refuses to work in R 2.9: Error in `sampleNames<-`(`*tmp*`, value = character(0)) : 'value' length (0) must equal sample number in AssayData (0) And I am unable to trace the source of the error. I've also tried

updated 16.2 years ago • Michal Blazejczyk

Hi, I'm working with .cel-files and after applying RankMerging function I loose my sample names. >eset <- justRMA(filenames = list.celfiles(path=celpath, full.names=TRUE)) >MergingSet <- RankMerging(eset ,"Spearman...eset ExpressionSet (storageMode: lockedEnvironment) assayData: 22277 features, 3 samples element names: exprs, se.exprs protocolData sampleNames: chr…

GO GO

updated 11.4 years ago • Guest User

run out of troubleshooting options. Any ideas or help would be much appreciated! ``` ### Generate vector with names of all genes detected in our dataset ALL.vector <- c(filtered_Pverr.annot$gene_id) ### Generate length vector...for all genes LENGTH.vector <- as.integer(filtered_Pverr.annot$length) ### Generate vector with names in just the contrast we are analyzing ID.vec…

goseq

updated 17 months ago • Danielle

another one I could see the following lines whcih I am unable to understand. In range 1: 'end' must be >= 'start' - 1.: .Call2(\"solve_user_SEW0\", start, end, width, PACKAGE = \"IRanges\")" Please check and let me know if I could provide any

Genomicranges IRanges

updated 6.2 years ago • bioinagesh

18137, 18886] - | TriTrypDB gene <NA> <NA> ID Name description size <character> <character> <character> <character> [1] LmjF.01.0010 LmjF.01.0010 hypothetical...750 web_id molecule_type…

GenomicRanges featurerequest

updated 10.3 years ago • Keith Hughitt

sample_id>(integer):511435, 489411, 551531, 511436, 511437, 489415, 551517, 489417 <sample_group>(character):G1, G2, G3 <slide>(numeric):204867380147, 204867380145 <array>(character):R04C01, R01C01, R07C01, R05C01, R06C01, R02C01...R08C01, R03C01 <barcode>(character):204867380147_R04C01, 204867380145_R01C01, 204867380147_R07C01, 204867380147_R05C01, 204867380147_R06…

Hi

updated 3.4 years ago • Afrin

probe profile.txt ... ... Error in `colnames<-`(`*tmp*`, value = c("PROBE_ID", "SYMBOL", "Status" : 'names' attribute [3] must be the same length as the vector [2] Each file can be read with read.ilmn independently (as you can see below...probe profile.txt ... ... Error in `colnames<-`(`*tmp*`, value = c("PROBE_ID", "SYMBOL", "Status" : 'names' attribute [3] must be the same lengt…

probe probe

updated 13.7 years ago • Katrina Bogan

Hello, I've used the Gviz User Guide to create a figure displaying a chromosome ideogram, the coordinate axis, a model of a single gene, and data points indicating the number of variants reported at each nucleotide position. After I successfully created it, I realized that there were data points showing up in the dead center of each intron of the gene model that I did not supply to DataTrack. T…

gviz r

updated 10.8 years ago • melissalee0

fdef, mtable): unable to find an inherited method for function "platformspecific", for signature "character". I want to use arrayQualityMetrics to analyse Affymetrix data- after preprocessing. Before using arrayQualityMetrics

arrayQualityMetrics arrayQualityMetrics

updated 13.8 years ago • Guest User

stopifnot(is(database_conn, "SQLiteConnection")) stopifnot(is(organism, "character")) stopifnot(is(genome_version, "character")) stopifnot(is(database_version, "character")) new( "regulondb", database_conn...and checked the *connect_database()* function, which is used to create the *SQLiteConnection* that must be supplied as first para…

regutools

updated 3.5 years ago • a.giachino2

IMMUNESIGDB") ``` Pre-Ranked gene list The GSEA() function takes a pre-ranked (sorted) named vector of statistics, where the names in the vector are gene identifiers. This is step 1 â gene-level statistics. ```{r} lfc_vector...lt;- de_genes_SHH_NORMAL %>% # Extract a vector of `log2FoldChange` named by `gene_symbol` dplyr::pull(logFC, name = symbol) lfc_vector <- sort(lfc_ve…

NanoStringDiff clusterProfiler fgsea

updated 2.6 years ago • pg45863

analyze my data: ```r > dba <- dba.contrast(dba, design = "~Condition") Computing results names... > dba <- dba.analyze(dba) Applying Blacklist/Greylists... Genome detected: Hsapiens.UCSC.hg38 Applying blacklist...error: Error in value[[3L]](cond): GreyListChIP error: Error: $ operator is invalid for atomic vectors Unable to apply Blacklist/Greylist. ``` …

DiffBind

updated 3.5 years ago • millerh1

then get the following error.</span> <pre> Error in if (any(input.mean < 0)) stop("input.mean must be non-negative") : missing value where TRUE/FALSE needed Calls: estimateCommonDisp -> equalizeLibSizes -> q2qnbinom

edger

updated 10.4 years ago • bastian.hornung

is not a column for each sample as demonstrated for microarray data in the 2009 GAGE vignette but a vector of 1 set of pairwise log2fold changes generated by Deseq2? How can I resolve this issue? Any advice would be much...appreciated, thanks. Format of my data “deseq2.fc”- a vector with KO gene IDs as names and pairwise log2fold expression values: `` Named num [1:5638] -0.0456 -0.2300…

gage gage package

updated 9.2 years ago • Michael

Error in .validate_names(rownames, ans_rownames, "assay rownames()", "rowData rownames() / rowRanges names()") : assay rownames() must be NULL or identical to rowData rownames() / rowRanges names() ``` I found that it has to do with "SummarizedExperiment

soggi

updated 6.8 years ago • nicolas.descostes

Rle> <IRanges> <Rle> <DNAStringSet> | <integer> <character> [1] chr1 [ 11767, 11966] + [AGACGGGGAA...CGGTGACACA] | 1 NM_198371 [2] chr1 [ 27488, 27687] + [TGATGATGAT...TCGTGCAGTC] | 2 NM_001017766...1061 sequences (1 circular…

sequence bsgenome

updated 8.4 years ago • nicola.romano

integer> [1] ctg123 1000-9000 + | NA gene NA <na> ID Name <character> <character> [1] gene00001 EDEN ------- seqinfo: 1 sequence from an unspecified genome; no seqlengths > import('test.gff3.gz...integer> [1] ctg123 1000-9000 + | NA gene NA <na> …

rtracklayer

updated 4.3 years ago • Charles

in the same order as heatmap clustered them. I used heatmap() function. And I can't read the row names. I read about RowInd and order.dendrogram(), but with no success at all. Thanks. -- Priscila Grynberg, B.Sc., M.Sc. Doutoranda

updated 16.3 years ago • Priscila Grynberg

to write.table) to write expression data to a text file, the output text file has one less column name (the probe ID column does not get a name), and the other column names are shifted all the way to the left margin in the text file...may be a little off here, depending on the display font, but here you can see that the probeset name is the row label) 6187.CEL 6188.CEL 6189.CEL 6190.CEL…

probe limma probe limma

updated 20.9 years ago • Ken Termiso

failed in loadNamespace() for 'httr', details: call: options() error: Value of SET_STRING_ELT() must be a 'CHARSXP' not a 'NULL' sessionInfo(R-4.1.0

PackageLoading

updated 4.1 years ago • dozhun

GRanges object with 490 ranges and 15 metadata columns: seqnames ranges strand | name score signalValue pValue qValue peakSummit annotation <rle> <iranges> <rle> | <character> <numeric> <numeric> <numeric> <numeric...integer> <character> [1] chr1L 2928590-29…

Xenopus_laevis ChIPpeakAnno

updated 2.9 years ago • stacy.genovese

treatments DMSO and sen are the refs *To really specify my confusion it is mainly the results names [3] and [4], but it would be nice to know information and methods behind names* [1]: https://www.bioconductor.org/help/course-materials

deseq2

updated 6.5 years ago • dennism9251

fit[,-1], cont[-1,2]) `` `` lmfitebayes <- eBayes(lmfit.cont) `` `` topTable(lmfitebayes, coef=name, number=Inf) `` Which fails when executing topTable sometimes. Thats because `` contrast.fit `` in some cases prefers not...to give a name to the coefficients (see below). It does not give the name if only a single contrast is being computed. If I than want...t…

limma

updated 8.1 years ago • wewolski

I finally made it to the 24chr DNAcopy multiplot but as my chromosomes are already named chr1 ... I get plot titles like 'Chromosome chr1' which is not nice and too long to see the actual chr number. Ideally, I would...like to not print 'Chromosome' Is it possible to substitute the plot titles with a vector of names. my current command is:   \# one plot per chromosome in mosaic &…

DNAcopy

updated 8.2 years ago • Stephane Plaisance | VIB |

hypetGTest function to do gene enrichment analysis, but there shows errors like this: invalid names for slots of class "GOHyperGResult": pvalues, oddsRatios, expectedCounts, catToGeneId The code Im using is : Ø params &lt...universeGeneIds = NULL, annotation ='hgu133a.db',ontology='MF') #where entrezGeneIds is a vector of gene probe names. Ø hyperGTest(params) all the packages a…

Annotation probe Category Annotation probe Category

updated 16.2 years ago • LIYUN

When using Rsubread v 1.28.1 it sucessfully parsed my input file names by removing the file path and just keeping the names. As of the current version, however, the names contain the entire file...path, this makes for very long and ugly column names. Example ---- Setup --- files: /path/to/file/here/file1.bam; /path/to/file/here/file2.bam countData=featureCounts(.....) ------- 1.28.…

Rsubread featureCounts

updated 6.6 years ago • wunderl

<div class="preformatted"> I downloaded a number of SNP 500K data from GEO to run with CRLMMM. The following CEL files specified by GEO as NspI files. > fulFileNames [1] "/Users/pcoyne/B_Cluster_DBased/GSE9222/NspI/GSM234158.CEL" [2] "/Users/pcoyne/B_Cluster_DBased/GSE9222/NspI/GSM234160.CEL" [3] "/Users/pcoyne/B_Cluster_DBased/GSE9222/NspI/GSM234162.CEL" > crlmm (fulFile…

SNP crlmm SNP crlmm

updated 16.5 years ago • mcoyne@boninc.com

to each location in GenomicRange ### <gr>, and masked with <letter> according to the masks named in ### <masklist> (which are encoded following BSParams convention). ### ### USE CASE - write fasta file of hard masked regions, using...My initial implementation FAILed as it used bsapply & BSParams ### whose FUN can not 'know' the name of the sequence (which was ### needed …

GO BSgenome BSgenome GO BSgenome BSgenome

updated 14.3 years ago • Malcolm Cook

Hello. I am trying to remove the gene names from a heat map I generated because there are many genes, and the gene names on the right side of my heatmap do not correspond

DESeq2

updated 4.5 years ago • Emma

them up iteratively as I process new data. What I've not been able to sort is how to define coulmn names after the dataset is created. It appears possible when you feed in a dataframe, but not a matrix. ```r # create a dataset using...I've been able to get it to work using the h5dfr package as an attribute so perhaps column names are using the h5writeAttribute? I haven't been able to sort the…

h5createDataset rhdf5

updated 2.9 years ago • kpalmer

technical replicate for each condition and, according to the user guide provided by Simon Anders, we must sum up their counts to get a single column corresponding to a unique biological replicate. At the end I end up with two...to estimate the dispersion of the normalized counts... an error message appears indicating that "X must be an array of at least two dimensions". I attach my results and th…

GLAD DESeq GLAD DESeq

updated 13.3 years ago • Andres Eduardo Rodriguez Cubillos

1)) stop("'path' must be character of length 1") pd <- read.table(file.path(path, file), sep="\t", header=TRUE, as.is=TRUE) checkColumns(pd, file, mandatory...f[1]) if (which(unlist(lapply(aux, is, "data.frame"))) != 1 | !all(c("val", "well") %in% names(aux[[1]])) | length(aux)!=2) stop("The output of 'importFun' must be a list with 2 components;\n", …

GO Cancer cellHTS cellHTS2 GO Cancer cellHTS cellHTS2

updated 17.2 years ago • Florian Hahne

Can I set the position of the name of the chromosome when using an IdeogramTrack? This code: <pre> transcriptID <- "ENST00000421310" chromosome <- "chr6" genome...http://s18.postimg.org/n9eliaf9l/show.png" style="height:250px; width:574px"/> * I would like the name of the chromosome to be placed above the chromosome, like the transcript name is placed above the tran…

gviz

updated 9.8 years ago • stianlagstad

I have a file with DNA sequence of length 900 characters. I use Biostrings package to read the sequence from the file into R. <pre> library(Biostrings) ref <- readDNAStringSet...pre>   I get something like   <pre> A DNAStringSet instance of length 1 width seq names [1] 900 AACTGGTTACCTGCCGTGAGTAAATT…

r biostrings DNAsequence

updated 9.7 years ago • Agaz Hussain Wani

Dear bioconductors Must be a very basic question but I'm unable to find how to generate an order ranked genelist to feed into gseKEGG function...Dear bioconductors Must be a very basic question but I'm unable to find how to generate an order ranked genelist to feed into gseKEGG function in...ClusterProfiler. I work on R and have a dataframe or matrix of gene names with associated FC values, pv…

gseKEGG order ranked gene list order rank

updated 8.4 years ago • bruno.saubamea

Hi, it would be nice if the first factor can be names differently than 'condition'. It is really hard to figure out that this needs to be specified and even that it is case-sensitive

DEXSeq

updated 9.1 years ago • bjoern.gruening

The query to the BioMart webservice returned an invalid result: biomaRt expected a character string of length 1. Please report this on the support site at http://support.bioconductor.org Thanks Stéphane

biomaRt error

updated 6.7 years ago • steppydeklin

qlf) summary(dt <- decideTestsDGE(qlf)) __Error in array(x, c(length(x), 1L), if (!is.null(names(x))) list(names(x),  :    'data' must be of a vector type, was 'NULL'__     sessionInfo() R version 3.3.3 (2017-03-06) Platform

edger DGE coef

updated 8.2 years ago • rebeccajane93

set is selective" [1] "Step2" [1] "Step2, fitting" [1] "start: get null distributions" Error in names(min_lk_values) = lk_names : 'names' attribute [4] must be the same length as the vector [2] In addition: There were 15 warnings

SpeCond

updated 10.2 years ago • meeta.mistry

following error: Error in .normargSeqlengths(value, seqnames(x)) : when the supplied 'seqlengths' vector is named, the names must match the seqnames Any chance you could help me with what is going on? Best wishes, Agnieszka -- output

updated 11.7 years ago • Guest User

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20060925/ 07901446/attachment.pl</div

updated 19.3 years ago • Bing Zhang

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20071023/ 3ea36b11/attachment.pl</div

updated 18.2 years ago • li lilingdu

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20070619/ df591863/attachment.pl</div

updated 18.6 years ago • Steven Wanyee

gt;> following error message: >> >> Error in strsplit(rownames(dcounts), ":") : non-character argument >> >> I would really appreciate any pointers that might help me correct my code >> or my input files...flattened_mm9.gtf") >> >> >> Error in strsplit(rownames(dcounts), ":") : n…

Annotation DEXSeq Annotation DEXSeq

updated 12.9 years ago • Matteo Carrara

I have two granges objects that I want to overlap based on the metadata column gene names - I essentially want to find the ranges that correlate to the same gene names between the two sets. Can anyone help me with

GenomicRanges

updated 4.5 years ago • grr4006

preformatted">Hi, there; I am new to bioconductor, thus I have a simple question. How to get gene names in arabidopsis array, I can get affyID, but hope to get gene name or find affyID for a list of genes. I tried > getSYMBOL("267139_s_at

updated 21.3 years ago • Fangxin Hong

ranges strand | exon_id exon_name <rle> <iranges> <rle> | <integer> <character> [1] chr9 [21967751, 21968241] - | 127318 <na> [2] chr9 [21968574, 21968770] - | 127319 <na> [3] chr9 [21970901, 21971207] - | 127320 <na> [4] chr9...and am not sure that I am calculating co…

Coverage Coverage

updated 12.9 years ago • Chris Cabanski

and GRangesList subject) by limiting the search to ranges in query and subject that have the same name? To be more concrete, I have 1. a GRangesList, where every (uniquely named) element corresponds to a transcript CDS, and 2. a GRangesList...with named elements corresponding to multiple transcript 3’UTR (per CDS). I would like to select those elements from list (2.) that...closest to the …

grangeslist

updated 9.9 years ago • Maurits

<div class="preformatted">Hi, I realized that subsetting an IntegerList object (and probably other IRanges list objects) by the list names plus replacing list element values behaves unexpectedly (at least for me) when the list is not sorted by its element's...realized that subsetting an IntegerList object (and probably other IRanges list objects) by the list names plus replacing list eleme…

updated 14.1 years ago • Manuela Hummel

in my legend for `shapeCustom` but am not sure of how to do so. When setting up my keyvals.shape vector, I tried using names with R `expression()` but this doesn't seem to work. Does anyone have any suggestions? In particular, suppose

EnhancedVolcano

updated 20 months ago • pl23

Hello, I tried to merge the two data frames which are having the same column name and the values set to NA. It showed me an error  > total<-merge(l,h,by="a") Error: cannot allocate vector of size 3.8 Gb Can

merge merge data frames

updated 8.5 years ago • shadhiksk

in BED format; when I transform the data into the AnnotationTrack in GVIZ, it says "cannot allocate vector of size 35.3 Gb" ;) It is difficult to imagine how a list of 30 000 peaks require 35Gb memory; please could you advise if there...file.bed",format="bed") PROTEIN\_CHIP\_track <- AnnotationTrack(PROTEIN\_CHIP, genome = "mm9",name="PROTEIN") Error: cannot allocate vector of size …

gviz

updated 10.5 years ago • Bogdan

is not available, only get ranges. Loading ranges... Done **Error in `[[<-`(`*tmp*`, name, value = character(0)) : 0 elements in value to replace 464 elements** It´s probably my mistake. I do not have experience working

KaryoploteR

updated 5.3 years ago • mpigozzi

gt; gr GRanges object with 10 ranges and 4 metadata columns: seqnames ranges strand | name score signalValue <rle> <iranges> <rle> | <character> <integer> <numeric> [1] chr1 237640-237790 * | . 70 10 [2] chr1 521500-521650 * | . 140 20 [3] …

rtracklayer

updated 3.4 years ago • Jake

exonsBy(hgTxDb, 'tx') That the object returned (eTx in this case) doesn't contain the transcript names. But if we use e <- exonsBy(hgTxDb, 'gene') The ensembl gene names are returned as the names of GRangesList "e". I'm wondering if...there's a convenient way of annotating the eTx object with the transcript names also? Thanks, Paul. -- Paul Geeleher (PhD Student) School of Mathematic…

updated 15.0 years ago • Paul Geeleher

Following along with the script provided by the lab group, they appear to have calculated a "PCA Vector", which they use in the creation of their design matrix. As far as I can tell, PCA, or Principal Component Analysis, is meant...for. The group has also provided their data which can be opened in R. When I utilise their "PCA vector" in the construction of my design matrix, I get the same valu…

PrincipalComponent StatisticalMethod edgeR MultidimensionalScaling Normalization

updated 2.9 years ago • rcreswell01