Bioconductor Forum

faculty position at the Assistant or Associate Professor level in cancer bioinformatics. Applicants must possess a doctoral degree in statistics, biostatistics or a closely related discipline. Research experience in biostatistics...becoming partially self-supporting with own grants. To apply, please send cover letter, CV, and the names of three professional references by July 31, 2008 to Philli…

Proteomics Cancer Proteomics Cancer

updated 17.7 years ago • Ru-Fang Yeh

Hi All, My name is Lucas, I'm currently doing an internship for my Master degree using Bioconductor to analyse the outcome of the HumanMethylation450...longer contains the function "sqliteQuickSQL". So I removed the current version of RSQLite that I must have updated since October 25th, and reinstalled the previous version (0.11.4), and then tried to reinstall lumi again

lumi

updated 10.7 years ago • lucashusquin

cts1,colData = coldata,design = ~ __covariate__) I am getting below error. It is not taking column names from covariate object. Am I doing wrongly.  __Error in DESeqDataSet(se, design = design, ignoreRank) :    all variables...in design formula must be columns in colData__ Is there any way I can automate if have more than two columns (eg . age) , instead of specif…

deseq2 design matrix

updated 7.7 years ago • vrehaman

I’m using the Splatter to generate single cell simulated data. I need to have a variability in samples which means that expression levels of genes should change across samples. I have 100 samples, 20 genes, 5 cell types and my code to generate single cell data is : ```r vcf <- mockVCF(n.samples = 100) gff <- mockGFF(n.genes = 20) params.group <- newSplatPopParams(batc…

SingleCellExperiment splatter

updated 4.2 years ago • Fatima

<div class="preformatted">Hi, I guess a lot of us have this problem: I'm storing "genome long" integer/doubles vectors for each position along each chromosome. I want to quickly access parts of these vectors in a manner quite similar/convenient/efficient to how we can quickly access the reads in a given region of a BAM file. I'm curios what you folks are using to store this type of info? …

GO Cancer cdf GO Cancer cdf

updated 14.9 years ago • Steve Lianoglou

the function ReadAffy. The error is reproduced here: Error in validityMethod(object): No slot of name "phenoLabels" for this object of class "phenoData" I don't know what's wrong. Any help appreciated. thanks, suresh _________________________________________________________________

Microarray Cancer Biobase affy Microarray Cancer Biobase affy

updated 22.2 years ago • James W. MacDonald

I want run deseq2 from tximport data. for sample dataset I can able to create deseq2 matrix file but for own data getting error i have kept same row(15) and column(15) name in condition and count data still getting error i have seen many already available question mentioned to update the versions after updating the version getting same error please help Thank you ```r library(DESeq2…

DESeq2 tximport

updated 22 months ago • hemantcnaik

value = colnames(countData)) : duplicate rownames not allowed</pre> But when I test the row names for duplications I can't find any. <pre> > anyDuplicated(rownames(countdata)) [1] 0 > table(table(rownames(countdata))) 1 12402

deseq2 DESeqDataSetFromMatrix duplicate

updated 7.8 years ago • Assa Yeroslaviz

<div class="preformatted">Dear all, Recently, I notice that several Support Vector Machine related patents had been granted to the company- Healthy Discovery Corporation since 1990s. In particular, the patent "Enhancing Knowledge Discovery from Multiple Data Sets Using Multiple Support Vector Machines" were granted in US, Europe, China, Australia, India, Germany, Israel and Norway. Besides,…

updated 14.8 years ago • Hsu Qinghua

as.integer(nFeatureValues),     logEvidence = as.double(123), node1 = vector(mode = "integer",         length = nDataItems - 1), node2 = vector(mode = "integer",   &nbsp...nbsp;    length = nDataItems - 1), mergeOrder = vector(mode =…

software error bhc

updated 10.6 years ago • jairo

FastqStreamer(fq) yield(strm) #> Error in x$yield(...): _DNAencode(): invalid DNAString input character: 'U' (byte value 85) readFastq(fq) #> Error: Input/Output #> file(s): #> /var/folders/r9/g3c47jrj40gc14d8qsqx7src0000gn...T//RtmpwZ8EOi/file4dee4320c214 #> message: invalid character ' t_fq_txt <- paste(c("@readid", …

ShortRead nanopore

updated 3.7 years ago • kent.riemondy

lt;- read.gdsn(index.gdsn(genofile, "sample.id")) pop_code <- scan("colors.txt", what = character()) rv <- snpgdsCutTree(ibs.hc, samp.group = as.factor(pop_code)) plot(rv$dendrogram, leaflab="perpendicular") I see in...the documentation for snpgdsCutTree that there is a pch.list option to specify the plotting character for different clusters. I've tried adding this o…

SNPRelate R

updated 9.6 years ago • rfriedman22

PRECEDEID FOLLOWID <rle> <iranges> <rle> | <factor> <integer> <integer> <integer> <character> <integerlist> <character> <characterlist> <characterlist> [1] chr5 20298238 - | intron 277333 277333 1 19778 839 ------- se…

VariantAnnotation

updated 4.0 years ago • paolo.provero

__IGNORE this issue.__ It is likely that I did something wrong at some point since I am having problems reproducing the problem myself.   tldr: it seems that after \`collapseReplicates\` the levels of newly created factors are shifted affecting the results. \*\*If\*\* this observation is correct and not a due to a mistake i my design, I suggest adding a warning in either in the functio…

deseq2 bug

updated 7.1 years ago • António Miguel de Jesus Domingues

Hi, I'm noticing what appears to be an incorrect translation of a codon with predictCoding(). It's somewhat difficult to see but below is output of all nonsynonymous amino acid changes. However, variant 3 at bp 1002 shows an M for TTG rather than an L. Is this a bug? Clearly TTG is an L in the standard codon table so I'm not sure how to resolve this (although it can be a start codon in some orgs…

VariantAnnotation

updated 8.4 years ago • creasyt

is readGPRHeader(). The error message suggests that this is failing because of a double-quote character as the first character on a line. This shouldn't normally cause any problems, so the error is probably to do with non...English (Norwegian?) character settings either in the GPR file or in your version of R. This is an R issue rather than a limma issue. Best wishes Gordon...Comment=Gal Crea…

limma limma

updated 16.1 years ago • Gordon Smyth

<div class="preformatted">If I got it right dataset "hsSeqs" (from microRNA package) has the same content as file "mature.fa" that can be downloaded from MirBase for Homo Sapiens miRNA identifiers and sequences. Whereas dataset "hsTargets" contains all target genes for Homo Sapiens miRNAs listed in file "mature.fa" but also for those listed in file "maturestar.fa" ??? My purpose is to…

miRNA Homo sapiens biomaRt microRNA miRNA Homo sapiens biomaRt microRNA

updated 16.3 years ago • mauede@alice.it

div class="preformatted">Hi Wei, if you want to obtain the correlation between your vector, say v, and each of the columns of a matrix (M) you can simply use the cor function on the augmented matrix having your vector

updated 13.1 years ago • federico.comoglio

Define a custom output format by specifying a comma-separated list of field names. Field names normally present in the "Extra" field may also be specified, including those added by plugin modules. Can also...See documentation for full details [default: off] --plugin [plugin_name] Use named plugin module [d…

Transcription HapMap PolyPhen SIFT convert genomes ensemblVEP Transcription HapMap SIFT

updated 12.0 years ago • Thomas Sandmann

github.com/YuLab-SMU/DOSE/wiki/how-to-prepare-your-own-geneList][1] ```r geneList = DEedgeR[,2] names(geneList)= as.character(DEedgeR[,1]) #up until here it was okay #but when I ran this last part geneList = sort(geneList, decreasing...TRUE) #I got this Error in do.call("cbind", lapply(x, "is.na")) : variable names are limited to 10000 bytes ``` I don't know what's wrong since I followed the sam…

clusterProfiler

updated 5.1 years ago • Emilia

regionR extendRegions

updated 7.0 years ago • Wojeff

<div class="preformatted">Hello all, I am using a pachage from Bioconductor TEQC, and when I load my reads as a bam file, the object created (class RangedData) looks like this RangedData with 6 rows and 1 value column across 84 spaces space ranges | ID <factor> <iranges> | <character> 1 1 [8404005, 8404254] | M00897:53:000000000-A4HU0:1:1101:192…

Cancer TEQC Cancer TEQC

updated 11.8 years ago • Radhouane Aniba

to search I get the following: <pre> Error in normargPattern(pattern, subject) : 'pattern' must be a single string or an XString object</pre> from normargPattern (Biostrings) ciring <pre> else if (!isSingleString(pattern...stop("'", argname, "' must be a single string or an XString object")</pre>   when I test the isSingleString function, the response is …

biostrings

updated 9.7 years ago • mike_and_dan

Hi all, I'm sure it's just me missing something obviuos... but I can't find PTEN in TxDb.Hsapiens.UCSC.hg38.knownGene. If I do this with two genes in hg19 I get the positions for both genes > library(AnnotationDbi) > library(TxDb.Hsapiens.UCSC.hg19.knownGene) > library(TxDb.Hsapiens.UCSC.hg38.knownGene) > AnnotationDbi::select(org.Hs.e…

TxDb annotation TxDb.Hsapiens.UCSC.hg38.knownGene

updated 6.0 years ago • bernatgel

solution? It is clear the problem is associated with my use of the 'metavars' argument which is "A vector of column names in metadata representing continuous variables". Clearly in both datasets some of the columns are not

DESeq2 eigencorplot PCAtools

updated 20 months ago • BioinfGuru

page. > raw.data <- ReadAffy() > hist(raw.data) Error in hist.default(raw.data) : 'x' must be numeric > boxplot(raw.data) Error in boxplot.default(raw.data) : 'names' attribute [12] must be the same length as the vector

cdf Biobase affy cdf Biobase affy

updated 19.8 years ago • Jenny Drnevich

this intercept? In theory I understand what the intercept is, but I don't understand how this vector capture the mean log expression for the first factor (WT) if the value is the same for every sample. Where the information...about the levels are in this vector? Thank you

limma linear model intercept

updated 8.5 years ago • marconerdaum

mas PM/MM correction : mas expression values: mas background correcting...Error: cannot allocate vector of size 32000 Kb #During LiWong normalization: invariantset PM/MM correction : pmonly expression values: liwong normalizing...Error: cannot allocate vector of size 32000 Kb</div

updated 22.3 years ago • Ann Hess

genomics and multi-omics data sets of Atlantic salmon. **Competence** The successful applicant must meet the conditions defined for admission to a PhD programme at NMBU. The applicant must have an academically relevant...five-year Norwegian degree programme, where 120 credits are at master's degree level. The applicant must have a documented strong academic background in genomics and be able…

JobPosting Transcriptomics GenomicVariation

updated 4.5 years ago • marie

<div class="preformatted">Persons interested in peer review of Bioconductor packages please send me an e-mail with content PACKAGE [package id] REVIEWER [your name and email address] then contact the maintainer of the package you are interested in (retrieve email address from the associated...of Bioconductor packages please send me an e-mail with content PACKAGE [package id] REVIEWER […

PROcess PROcess

updated 23.8 years ago • Vincent J. Carey, Jr.

expression analysis comparing multiple groups at the same time. My sampleTable is the following: Name Condition Differentiation AF_MSCs_1 AF_MSCs_1 AF_MSCs low AF_MSCs_2 AF_MSCs_2 AF_MSCs low AF_MSCs_3 AF_MSCs_3...or interaction terms in the design formula are linear combinations of the others and must be removed. Please read the vignette section 'Model…

deseq2

updated 5.7 years ago • dequattro.concetta

control","hydro_phos"),res = res).</pre> I confronted an error: <pre> Error in results(dds.shr, name = coefAlpha) : object 'coefAlpha' not found</pre> My codes are: <pre> setwd("C:/cygwin64/home/Coexpression_Nov2017") getwd() library

deseq2

updated 8.2 years ago • lychen83

title genome tags <character> <character> <character> AH50420 clinvar_20160203.vcf.gz hg19 dbSNP, GRCh37, VCF AH50421 clinvar_20160203_papu.vcf.gz

annotation software error vcf annotationhub

updated 9.7 years ago • sskimb

from tx2gene: 36704 summarizing abundance summarizing counts summarizing length Error: all(names(aveLengthSampGene) == rownames(lengthMat)) is not TRUE In addition: Warning messages: 1: In rowsum.default(abundanceMatTx...3: In rowsum.default(abundanceMatTx * lengthMatTx, geneId) : missing values for 'group' 4: In names(aveLengthSampGene) == rownames(lengthMat) : longer object length …

tximport salmon R bioconductor

updated 8.5 years ago • macmanes

theIDs <- getBM(attributes="affy_huex_1_0_st_v2", filters="entrezgene",values=10948, mart=ensembl) names(theIDs) <- 'psets' > theIDs psets <na> <na> <na> <na> <na> <na> <na> <na> <na> 3720380 3720356 3720363 3720372 3720377 3720358 3720375 3720344...to find an inherited method for function âdbGetPreparedQueryâ fo…

oligo oligo

updated 12.3 years ago • Assa Yeroslaviz

Hi all, I am currently using online data set just to run RAPIDR analysis. I have Chromosome 1.bam file for 2 samples. library(RAPIDR) library(SummarizedExperiment) makeBinnedCountsFile(bam.file.list=c("file1\_chr1.bam", "file2\_chr1.bam"), sampleIDs=c("sample1", "sample2"), 'output.fname', k=20000) after runnning this i am getting warning  __Warning messages:__ __1: In .Seqinfo.mergexy…

Rapidr

updated 7.4 years ago • raya.girish

anova' function for MAList objects. However you could use it for your data by setting 'x' to be a vector of log-ratios or log-intensities and 'group' to be a vector which takes value '1' for group1, '2' for group2 etc etc. I cannot tell...gt;bwss <- function(x,group). > >Your docu. explains they are: > >x: a numeric vector giving the responses. >group…

limma PING limma PING

updated 22.6 years ago • Gordon Smyth

to be that in order for a `` REF `` interval to overlap a `` TEST ``interval, it must cover >50% of `` TEST `` interval.  I've been playing around with GenomicRanges. However, the `` findOverlap...13468022L ), Deft = c(1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1)), .Names = c("chr", "start", "…

genomicranges

updated 10.3 years ago • khauser130d

things like %in% and intersect, but no luck (I am guessing because the rows are different beyond the name. I did read the section on filtering reads (and I have already filtered low counts). But couldn't figure out how I could filter

deseq2

updated 6.4 years ago • rattray56

Checking to make sure that I should be able to combine them (from the eSet documentation): #eSets must have identical numbers of 'featureNames' > all(featureNames(tmp[[2]])==featureNames(tmp[[2]])) [1] TRUE #must have distinct 'sampleNames...gt; any(sampleNames(tmp[[1]])%in%sampleNames(tmp[[2]])) [1] FALSE #and must have identical 'annotation'. > annotation(tmp[[2]])==annotation(…

updated 18.0 years ago • Francois Pepin

GACTGACTGACT subject: [1] AAGAAGAGTTATGGGAGTAACTGACC score: -77.67886 As you can see, the last character of the pattern ("G") has been removed. If I set type="global-local" this does not happen, but it does in this instance: pairwiseAlignment...pattern: [2] CTGACTGACTGACTG subject: [1] CTGAGAGGGTGATCG score: -31.55991 In this case the first character of the pattern ("A") was removed in the al…

Alignment Biostrings Alignment Biostrings

updated 13.9 years ago • Erik Wright

the pearson correlation (and p-value) for a gene dataset ( 6000 rows x 10 columns). For each row vector, I wanted to calculate the p-value with respect to the other row vectors. My resulting p-value matrix should be of size

updated 20.8 years ago • Dren Scott

R> showMethods("split") Function: split (package base) x="ANY" x="GRanges" (inherited from: x="Vector") x="RangedData" x="SummarizedExperiment" (inherited from: x="ANY") x="Vector" R> split(rowData(sortedBloodCells), seqnames

GenomicRanges GenomicRanges

updated 13.0 years ago • Tim Triche

found that keggLink returns nothing as shown below:   > KEGGREST::keggLink("hsa", "pathway") character(0)     Any idea

keggrest clusterProfiler

updated 10.4 years ago • Guangchuang Yu

with 22 rows and 1 value column across 2 spaces > space ranges | score > <character> <iranges> | <integer> > 1 A [ 1, 3] | 0 > 2 A [ 4, 4] | 1 > 3 A [ 5, 5] | 2 > 4 A [ 6, 6] | 3 > 5 A [ 7, 7] | …

Coverage convert rtracklayer ASSIGN Coverage convert rtracklayer ASSIGN

updated 15.7 years ago • Yvan

seq data from TCGA using edgeR. The results of differential expression analysis has NAs under Gene names and Gene symbols. The EntrezID corresponding to it doesn't give a valid Gene name. What could be wrong? The following command

edger differential expression TCGA Gene ID

updated 5.8 years ago • fawazfebin

and tell me what the new error message is? Also, you should include in your scan annotation a character vector "sex" with values of "M" or "F". The code treats males and females differently for X chromosome SNPs, and will complain...something in this can point clearly to what I am doing > wrong. > > I am using an integer vector of 1 to the total number of snps for my snp &a…

SNP Annotation cdf GWASTools SNP Annotation cdf GWASTools

updated 12.6 years ago • Stephanie M. Gogarten

Hi, Aim: I am trying to get the positions of all stop codons and type of the stop codon given a DNAstring object or a character string. ``` stops <- c("TAG","TAA","TGA") vmatchPattern(stop, stringObj) ``` I also tried to define stops as ```"TAA|TAG|TGA"``` and I know non...to get the positions of all stop codons and type of the stop codon given a DNAstring object or a characte…

pattern Biostrings

updated 3.3 years ago • fortytwo.teacups

seqnames strand cigar qwidth start end width ngap <rle> <rle> <character> <integer> <integer> <integer> <integer> <integer> [1] chr1 - 92M 92 243675625 243675716 92 0 --- seqlengths: chr1 chr2 ... chrUn_gl000226...seqnames strand cigar …

Alignment Alignment

updated 12.4 years ago • Elena Grassi

13: scanBcfHeader(file, ...) 14: Map(function(file, mode) { bf <- open(BcfFile(file, character(0), ...)) on.exit(close(bf)) scanBc 15: standardGeneric("Map") 16: eval(.dotsCall, env) 17: eval(.dotsCall, env) 18: eval(expr, envir, enclos...FUN = f, ..., SIMPLIFY = FALSE) 21: (function (file, mode) { bf <- open(BcfFile(file, character(0), ...)) on.exit…

ensemblvep

updated 11.1 years ago • Moiz Bootwalla

examples below). Does anyone know why this might be? >  keggConv("hsa", "uniprot:Q06187") character(0) >  >  keggConv("hsa", "uniprot:P04637") character(0) >  >  keggConv("hsa", "uniprot:P31749") character...0) >  > keggConv("hsa", "uniprot:P00533") character(0) >  &…

KEGGREST keggConv

updated 10.0 years ago • Asta Laiho

<div class="preformatted">The code below, which produces the error message and sessionInfo which follow, was working last week but now is not. I got into this because I am having trouble with the Category package and wanted to rebuild my build of ragene10stv1.db package that Category was depending on. This build, which had gone uneventfully last week, produced the error below. I moved both …

ChipName db0 affy Category AnnotationDbi ChipName db0 affy Category AnnotationDbi

updated 17.2 years ago • Mark W Kimpel

Annotation Cancer IRanges GenomicFeatures GenomicRanges Annotation Cancer IRanges

updated 15.3 years ago • Steve Lianoglou

div class="preformatted">Hi Anthony, See help(maSub) maSub isn't a vector representing "good spot". Instead, its is there to indicating which spots are currently being considered in the matrix...original matrix is x = 100 by 5 and you applied a subset of x[1:10,] then maSub will be a logical vector of length 100 with the frist 10 values equal to TRUE and the rest equal to FALSE. If you wan…

Microarray Normalization Microarray Normalization

updated 21.8 years ago • Jean Yee Hwa Yang

<div class="preformatted"> This may be a very basic question, but I am looking in the R manual and I haven't found the right function... and I am sure it must exist already. So I apologise in advance if I seem to be blind or missing something! :) What I am after is very simple. I am using Limma and I have a number of data frames (RGList, MAList, MArrayLM...). Sometimes I just want to locat…

limma limma

updated 19.8 years ago • J.delasHeras@ed.ac.uk

because of correction and other english errors. WHAT WE EXPECT FROM A CANDIDATE: - Applicants must be living in USA,Canada, Australia or United Kingdom. - Applicants must be high school or vocational high school graduates...Above 18 years old. - Confident computer skills. - Applicants must be avaliable to check his/her e-mail messages between 7am - 12noon. - Good working rela…

updated 18.0 years ago • Storistes de France

out how to tell the various functions which > spots to use. I understand how to set the maSub vector in the layout > object, and my understanding is that the normalization functions will > then use this vector to know...filter function. What would be the > corresponding way to do this using marray? I'm assuming I must set > the name.W parameter when I call re…

aCGH Microarray Normalization GO Cancer Biobase annotate genefilter affy affydata limma

updated 19.0 years ago • Gordon Smyth

vjust = -1.5, size = 3) </pre> However I get the error <pre> Error in .local(data, ...) : label must be one of column names</pre> This error doesn't appear if I revert to the previous version of ggplot2, keeping the same version...of ggbio. Any particular workaround? I tried to put the names as metadata to the GRanges object and use the "column" name as label, but didn'…

ggbio ggplot2

updated 7.3 years ago • Lescai, Francesco

signature (x = data.frame, y = data.frame) assumes that the class of a given column is a one-length vector (in various if and switch statements). However, class(x) can return a vector of length > 1 for S3 objects. This is the case

updated 16.0 years ago • Kasper Daniel Hansen

here, the black and red lines etc? Upper and lower plots, there are 4 in total. batch = des2$BATCH \#vector of numbers refering to the different batches of the samples modcombat = model.matrix(~1, data=pheno) \#yields a vector of

limma normalization microarray

updated 10.4 years ago • chris86