Bioconductor Forum

I got some E. coli K12 sequencing results where the mutated genes were labelled with their gene locus ID (f.i. b0014) and the gene name (f.i. dnaK), but...without the gene ID. If I want to do GO for instance with clusterProfiler it seems like all the functions only allow a list of gene ID as inputs...Using gseGO() it didn't work with either using gene names or gene locus IDs. An example of what…

cluster OrgDb clusterProfiler

updated 3.1 years ago • o.mattmann

It is generally advised to filter low count genes before performing differential expression on RNA-seq data, and this should be done independently of the sample labels...or metadata to avoid data snooping. But what if sample sequencing depth happens to be strongly correlated with groups? Does using a filter based on raw counts introduce bias in...this case, since the group with more deeply-sequen…

edgeR deseq2 rna-seq independent filtering

updated 10.6 years ago • Ryan C. Thompson

I'm concerned that there may be something wrong with my PureCN output from callAlterations(), which I ran via PureCN.R. I have 117 gastric cancer tumor samples and about 740 targeted genes. This gives about 87664 total lines of callAlterations() output from all the samples together. Of those, there are only 689 amplifications and 78 deletions. When one looks at the distribution of copy ratios…

PureCN gene amplification deletion loh

updated 5.7 years ago • twtoal

type="precursor", species="hsa") ``` I get no results back. > hsa_precursor [1] Accession Name Sequence <0 rows> (or 0-length row.names) But if I use replace "precursor" with "mature", I got the info back successfully...head(getAllMiRNAs(version="v22", type="mature", species="hsa")) ``` > Accession Name Sequence 1 MIM…

miRBaseConverter precursor getAllMiRNAs

updated 5.5 years ago • gzbyzyx2011

We are investigating whether this was lab error, or a need for a different normalization. If most genes differentially express, you should abandon q-values. The reason is obvious if you think about it - the q-value is the...estimated percentages of false detections. If 90% of the genes actually differentially express, the max. q-value is going to be 10%, even if you declare all the genes signi…

Normalization limma Normalization limma

updated 20.5 years ago • Naomi Altman

I have an ENSEMBL-based RNA-seq dataset that I would like to annotate. For that I use the library`` EnsDb.Mmusculus.v79 ``. However, I am somehow not able to retrieve the gene name (description). Based on the retrievable annotation info, I assumed this would be accessible through the argument`` columns = "GENENAME" ``, but this turns out not to be the case (that rather is the same as `` "SYMBOL…

EnsDb.Mmusculus.v79 ensembldb annotation

updated 8.4 years ago • Guido Hooiveld

t remember the name anymore where the basic idea is to score each patient 1 or -1 based on whether they express a gene more than the mean expression...plyr) expression <- data.frame(rep(1, 563)) #Create a dataframe to put the date in for (i in 1:length(chr.list)) { #chr.list is a list of genes x <- getProfileData(mycgds, chr.list[i], "ov_tcga_mrna_median", "ov_tcga_all") if(leng…

Survival Ovarian Survival Ovarian

updated 13.8 years ago • Ahmet ZEHIR

from FeatureCounts GeneLength = (read.delim(feature.length, row.names = 1)) #read file with gene length of genes to calculate RPKM #I have five replicates for each treatment: head(counts[1:5]) NT1 NT2 NT3 NT4 NT5 AT1G01010...treatment = factor(treatment, levels=c("NT","WT","RT","DT")) #Create Differential Gene Expression List Object (DGEList) o…

edger complexheatmap R clustering

updated 5.7 years ago • eggrandio

<div class="preformatted">Dear all, The new Ensembl marts for release 72 are live on www.ensembl.org. You can change your host to access our most recent data: mart <- useMart(biomart="ENSEMBL_MART_ENSEMBL", host="www.ensembl.org", path="/biomart/martservice") Ensembl Genes 72 Updated Human assembly to GRCh37.p11 Reinstated PolyPhen prediction and score filters and a…

PolyPhen PolyPhen

updated 12.6 years ago • Thomas Maurel

p/128407/ However, in the grand scheme of things, I really want to find out which genes/transcripts are mapped to a set of GOslims. Since GSEABase is able to map GO terms to GOslims, it seems like identifying...corresponding gene/transcript IDs should be feasible. Unfortunately, I have no idea how to proceed. If I have an input file with GO terms and...corresponding gene/transcript IDs (not…

gseabase go gene ontology goslim

updated 5.9 years ago • samwhite

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20060925/ 07901446/attachment.pl</div

updated 19.3 years ago • Bing Zhang

tests than "separate". I > ran some analysis using "global" and then I realized that since my gene > lists of interest were different for each contrast, I decided that > "separate" may be the better choice. What puzzled...tests, but this doesn't happen so often. The reason for this phenomenon is the step-up or step-down nature of these adjustment methods, which takes the who…

GO limma GO limma

updated 17.7 years ago • Gordon Smyth

c('time_id', '0', '3')<br/> c(0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1)</code> Looking for the genes with maximal fold changes in the size factor-normalized counts identifies a large number of very similar genes (i.e...names identical apart from a number, no difference in description on GeneCards) with log2 fold changes less than -4. However...these genes are highly variable, an…

deseq2 rnaseq differential gene expression

updated 9.9 years ago • willmacnair

I have a DNA sequence files and many sequences start like this  "CCCATGCAGACATAGTG" or  "CTCCATGCAGACATAGTG" and I have a tag...sequence which is "ATGCA". I want to remove all the "ATGCA" as well as "CC" or "CTC" before that. So the final product will be  "GACATAGTG...trimLRPatterns in biostrings but it does not work since it only trim from the end but…

bioconductor

updated 10.8 years ago • kelvinfrog75

that we are not trying to find the difference in decay rate between two conditions, but rather rank genes by their decay rate in a single condition. That is, in the above model, we are interested in ranking genes by the `b` coefficient...is saturated (that is we have sequenced every molecule present in our cDNA tube) we don't expect counts from highly expressed genes to crowd out counts from...th…

DESeq2

updated 20 months ago • i.sudbery

em></pre> 2. In the author's result file before and after annotation, the probeset column has a name "ID".  My result file does not have any name in the first column. Author's file:  <pre> <span style="background-color:Yellow...strong>(storageMode: lockedEnvironment) assayData: 41345 features, 20 samples element names: exprs protocolData rowNam…

limma annotation pd.mogene.2.0.st mogene20sttranscriptcluster.db affy

updated 11.0 years ago • alakatos

Hello, I´m interested in finding reference genes for qPCR in my RNAseq data. I use therefore the following parameters: altHypothesis="lessAbs",lfcthreshold=0.5, alpha...Hello, I´m interested in finding reference genes for qPCR in my RNAseq data. I use therefore the following parameters: altHypothesis="lessAbs",lfcthreshold=0.5, alpha=0.05 to detect the most stable genes: I am not sure if I h…

lessAbs reference_genes DESeq2

updated 3.4 years ago • sj

alignments are excluded). I think from your original question you are really looking to provide the names of the sequences in your BSgenome object as a value to the chr.select argument of MEDIPS.createSet, I *think* chr.select...the BSgenome object. The initially reported error Calculating genomic coordinates...Error in vector(length = supersize_chr[length( chromosomes)], mode = "character") : …

Alignment GO Cancer BSgenome BSgenome Rsamtools genomes MEDIPS Alignment GO Cancer

updated 11.8 years ago • Vining, Kelly

nbsp; I'm working with miRNA and Biostrings R package and I have an issue: I want to retrieve the sequence of 3'UTR extreme from a set of gene IDs. This is my code: > ensembl <- useMart("ensembl", dataset=as.character(data_sel

R Biostrings sequence

updated 8.8 years ago • aspenaure

This variables trigger an error report when using ReatcomePA:enrichPathway example code: ```r gene <- c("11171", "8243", "112464", "2194", "9318", "79026", "1654", "65003", "6240", "3476", "6238", "3836", "4176", "1017", "249") yy = enrichPathway(gene, pvalueCutoff...END OF FAILURE REPORT -------------- Error in is.null(PATHID2NAME) || is.na(PATHID2NAME) : 'length(x) = 2257 &…

DOSE ReactomePA

updated 4.9 years ago • Lluís Revilla Sancho

Cancer Danio rerio zebrafish Cancer Danio rerio zebrafish

updated 16.4 years ago • Hervé Pagès

div class="preformatted">Hello, I'd like to make clear how the 'Heat Map for Genes in Dataset' which is one of plots in the '(project name).global.plots.pdf' and is generated by the Gene Set Enrichment Analysis...gsea="" www.broadinstitute.org=""> My understanding is that each row represents one gene in the data set which is somehow normalized and the columns are grouped according to the …

Genetics Clustering DECIPHER Genetics Clustering DECIPHER

updated 15.8 years ago • Radek Blatny

on S4 objects. * With unnamed arguments: > c(IRanges(), IRanges()) IRanges of length 0 > c(Rle(), Rle()) logical-Rle of length 0 with 0 runs Lengths: Values : * With named arguments: > c(a=IRanges(),b=IRanges()) $a IRanges...of length 0 $b IRanges of length 0 > c(a=Rle(), b=Rle()) $a …

Cancer IRanges BiocGenerics Cancer IRanges BiocGenerics

updated 13.1 years ago • Hervé Pagès

to strand/subset and running each. Especially my task is a little more complicated: I need to find gene expressions (counting sequences in exonic regions of each gene). I also gave BEDTools a try, but it does not fulfil my needs...extremely slow for a gene list of 28k). I ended up with coding a c++ code to do the job. Thanks for all of your suggestions and helps guys. D. </div

updated 14.9 years ago • Duke

downloads KEGG pathways. Then, these pathways are augmented by integrating miRNA interactions into gene networks. The resulting pathways (augmented pathways) are graphNEL objects, looking as follows: > augmented_pathways_mmu_04727...library(graphite) > MouseReactome <- pathways("mmusculus", "reactome") > names(MouseReactome)[1:10] …

pathview mirintegrator miRNA

updated 8.2 years ago • lech.kaczmarczyk

Since `DEXSeq::estimateDispersions()` and `DESeq2::estimateDispersions()` are often the most time-consuming step of the two pipelines I was wondering if it was possible to share the result of this between a (naturally

DESeq2 DEXseq

updated 4.0 years ago • k.vitting.seerup

How can I find the name of the file that a particular R script is missing?   I have copied a functional R script into a new directory and it does...row.names(eset); Systematic = as.character(unlist(mget(Probesets, y2systematic, ifnotfound=NA))) names(Systematic) = Probesets Common = as.character(unlist(mget(Probesets, y2common, ifnotfound=NA))) names(Common) = Probesets...k…

microarray input files saccharomyces cerevisiae bioconductor

updated 11.0 years ago • Thomas.F.Hahn2

Hello, I am running differential expression analysis on age-related changes in transcription using natural splines with DESeq2 like so: ```r dds <- DESeqDataSetFromMatrix(countData = counts, colData = coldata, design = ~ ns(age_scaled...coef(dds) design_mat <- model.matrix(design(dds), colData(dds)) dat…

deseq DESeq2

updated 2.2 years ago • georgii.vdovin

tximport.html#salmon-sailfish. I ran the code below and got the results of 'txi' which includes '"abundance" "counts" "length" "countsFromAbundance". **Does the 'counts' mean 'TPM values'?** setwd('C:/Users/wj/Documents/Projects/RNA pipeline...header = TRUE) samples files <- file.path(dir, "results", samples$run, "quant.sf") …

RNA-seq Salmon tximport

updated 6.4 years ago • woojoy14

Hello, I have RNA-seq data from testis tissue of a natural population of 3 closely related bird species (5 individuals each). I have detected several thousands (3195) differentially...expressed genes in one of my comparisons between the two groups. When looking at some of the differentially expressed genes, I see quite...high variation within one of my groups as shown for one example gene bel…

DESeq2

updated 5.1 years ago • hpapoli

that I expect. When I execute the query in R as above, I get a dataframe with the expected column names, but no rows. I get no error message. I am wondering if the query string is too long. Is there a maximum length for queries in

RdbiPgSQL RdbiPgSQL

updated 20.3 years ago • William McCoy

a vector with one integer per row of data, or only the unique interger values for each scaffold length I get an error (see code below). I've made a hacky work around but was wondering if there is a more elegant way of adding the...c18977.IR <- IRanges(start = c18977$sub_start, width = abs(c18977$sub_start - c18977$sub_end), names = seq(1:length(c18977$sub_start)))</pre> 4) create t…

GRanges seqnames seqlengths IRanges

updated 11.3 years ago • topher.hamm

to generate read counts for my RNA-seq data, but when I realized I was working with (I think) RefSeq gene annotations, the only txdb variable I was successfully able to generate was using > # Install the latest version of DEseq2...Documents/School/HagermanLab/Data/RNAseq/RedoRNASeqAnalysis/") > > # read in file names files <- read_csv("samples_FXTAS…

tximport Gene IDs txdb RefSeq Salmon

updated 5.9 years ago • holmkn

Hi, I was trying to use the keggLink function to find all genes associated with all reactions. However, it returned an error like this. ``` > keggLink("reaction","genes") Error in .getUrl(url...1, valueColumn = 2) : Bad Request (HTTP 400). ``` However, keggLink seems to work for enzymes and reactions and various other combinations. Is there any way to fix this? If keggLink i…

software error keggLink R

updated 6.0 years ago • superdanny68

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20070907/ 36835f42/attachment.pl</div

updated 18.3 years ago • Alessandro Fazio

Hi I am currently working on an amplicon sequencing dataset and using DESeq2 to identify differentially abundant taxa across my sample groups. I have a question...geom_bar(stat = "identity") + coord_flip() + theme_minimal() + labs(title = "Differentially Abundant Taxa", x = "Taxa", y = "Log2 Fold Change") ## #### Correcting after considering leaves, gut and faeces in each month as a potential…

Bioconductor

updated 3 months ago • acharyapratiksha24

Hi all, I am running WGCNA on my big gene expression data set, and running into a bunch of errors. I appreciate any help in advance that you can provide in navigating...going forward with a power of 28, although I have also tried other powers and gotten the same error: "Length of colors vector not compatible with number of objects in 'order'." When I run the length of colors and order are diff…

WGCNA

updated 2.1 years ago • aehall26

for speed up) 1 2 3 4 5 6 transcripts missing from tx2gene: 22002 summarizing abundance summarizing counts summarizing length summarizing inferential replicates I would like to ask if, in this way...txi.kallisto.tsv, sampleTable, ~condition) using counts and average transcript lengths from tximport > dds <- DESeq(dds) estimating…

tximport

updated 6.6 years ago • Mozart

my goal is to generate a file with the miRNA identifiers (Ex: hsa-miR-93), the correspondent miRNAs sequence (Ex: CAAAGUGCUGUUCGUGCAGGUAG) followed by the list of target genes identifier and relative 3'UTR sequence. Thanks...generate a text files containing > a list of Homo-Sapiens validated miRNAs (microRNA-identifier, sequence) > and relative 3'UTR regions (gene-identifier, 3'UT…

miRNA Homo sapiens biomaRt miRNA Homo sapiens biomaRt

updated 16.5 years ago • mauede@alice.it

I'm very new in this field. We used single-cell RT-PCR on neurons to quantify the expression of 60 genes (Fluidigm) and then try to map them to their electric phenotypes . As expected , we got a lot of "zeros" values for the genes that...with a negative binomial as advised in the article (Droplet scRNA-seq is not zero-inflated, svenson ,nature biotech, 2020 [link][1] I tried to use their …

microarray

updated 5.8 years ago • fabien.tell

Hi All, I have a list of 500 genes in ENSMBL ID format and I need to convert them to gene symbols. Here is an example: ENSG00000004468 gene symbol: CD38 I tried...the following online tool but it failed to convert some of my genes, while I can find them when I search in the ENSMBL data base. Do you know if there is an updated R package with human gene annotations...What package…

annotation

updated 5.7 years ago • Hamidreza Hashemi

set obtained using `` pRolocmarkers ``function. \# Set parameters for _Homo sapiens_ with Gene symbol identifier <pre> >hsap <- pRolocmarkers("hsap")</pre> \# Next load my custom data a \`MSnSet\` S4 object using the `` readMSnSet2...e,hsap)) Error in addMarkers(e, hsap) : No markers found. Are you sure that the feature names match? Feature names: 1, 2, …

proloc proteomics msnset

updated 7.9 years ago • moldach

Hello, I have around 2000 nucleotide sequences stored in each row in an excel sheet. I want to run BLAST over each one of them individually and extract the "Description...of the first hit. Like for Example: Suppose on NCBI BLAST website I insert one query sequence and hit BLAST with Homo sapiens as organisms. I extract the description of the first hit and paste it aside the sequence...this o…

SequenceMatching SequenceAnnotation

updated 3.8 years ago • Prateek

dataset with some pretty clear spatial artifacts that I'd like to mask out. However, harshlight (the most commonly cited package for this sort of thing) appears to be only set to work with AffyBatch objects, not the RGLists that...are generated by Limma (which seems the most natural way I've found for processing raw data from Agilent arrays). Thoughts? Many thanks, David </div

Harshlight Harshlight

updated 16.2 years ago • David Garfield

1]] %in% lb, "orange", "grey") label_color[is.na(label_color)] <- "grey" names(label_color[label_color == "grey"]) <- "NA" names(label_color[label_color == "organe"]) <- "lysosome

EnhancedVolcano

updated 2.8 years ago • Phương Thùy

c("OrgDB", "NCBI", "Rattus norvegicus")) AnnotationHub with 1 record # snapshotDate(): 2016-08-15 # names(): AH49585 # $dataprovider: ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ # $species: Rattus norvegicus # $rdataclass: OrgDb # $title: org.Rn.eg.db.sqlite...ORGANISM: Rattus norvegicus | SPECIES: Rat | EGSOURCEDATE: 2015-Aug11 | EGSOURCENAME: Entrez Gene | EGSOURCEURL: ftp://ftp.ncbi.nlm.…

AnnotationHub

updated 9.3 years ago • Jenny Drnevich

animal movement using different landscape patterns, and each male-female meeting get a chance of genes exchange. So, on the beginning of the simulation we define a loci structure like: LOCI_struct_start=[ [0,1,0,0,1,1] , [0,1,0,1] ] where...number of alleles (6 and 4). When female meet a male, there are a chance of female pass the genes combination to offspring, like LOCI_struct_end=[ [1,1,0,1,1,…

updated 15.9 years ago • milton ruser

872899] chrY 56879863 * [872900] chrY 56885734 * ------- seqinfo: 24 sequences from an unspecified genome; no seqlengths ``` I'm pulling annotation data from TxDb.Hsapiens.UCSC.hg19.knownGene...to annotate each position with promoters and genes. Before using `nearest`, `findOverlaps`, ... I thought to collect the information in a single object with sensible names for.…

GenomicRanges

updated 3.0 years ago • Lluís Revilla Sancho

Rle_getStartEndRunAndOffset", x, start, end, PACKAGE = "IRanges") : 'x' values larger than vector length 'sum(width)' Here is my code: > library("easyRNASeq") > library(BSgenome.Mmusculus.UCSC.mm9) > annot <- load("gAnnot.rda...Mmusculus), + format = "bam", + annotationMethod = "env", + annotationObject = exon_range, + count = "genes", + summarization = "geneMode…

RNASeq Annotation Organism BSgenome BSgenome easyRNASeq RNASeq Annotation Organism

updated 13.3 years ago • Guest User

a result of having low counts (0,1,2 etc) in one species and high counts in the other for the same genes. When you compare different species, I'd intuitively expect almost every gene to be differentially expressed to some...change, genes' logFC is positively correlated > with mean log CPM, something I haven?t seen before in Edger standard runs. > 2) most genes...Sep 2014, assaf www…

Normalization Organism edgeR

updated 11.3 years ago • Gordon Smyth

all, What test should be done on ~40 samples, each in triplicate, to determine which sample is the most different to all samples? and What test should be done to determine the two samples which are most different? </div

updated 13.8 years ago • Ali Mohammadian

from the ProteinPilot software (Sciex) after searching 4 raw files (.wiff) of DDA data against a sequence database obtained from UniProt. After reading it into R with the PSMatch package the following error message appears

RforProteomics Proteomics ProteomicsWorkflow

updated 2.4 years ago • mmvar

Wondering about the most straightforward way to take a list of genes and create a GRanges object, so basically pull the intervals for lets say a...list of 500 RefSeq genes? Thanks

granges bed genomicranges genomeintervals deseq2

updated 8.0 years ago • rbronste

I'm trying to match a list of uniprot mouse IDs with ensembl protein, transcript, and gene IDs. So I download `` biomaRt `` data: `` require(biomaRt,quietly=T...ensembl_gene_id","external_gene_name","description"),mart=mart) `` However, many in my list of uniprot mouse IDs do not have a match in the `` mart.df `` I downloaded.  For example: Q922S4 is in my…

biomart getDB

updated 8.9 years ago • rubi

div class="preformatted">Dear All, I want to retrieve gene symbols for microarray probes such that I receive some output even if no gene spans the probe. I am using position information...in biomaRt for this: genes=getBM(attributes = c("hgnc_symbol"), filters= c("chromosome_name","start","end"), values = list(rep(i,length(posnew)),posnew,posnew...ensembl) Unfortunately, it seems that biomaR…

Microarray Cancer probe biomaRt ASSIGN Microarray Cancer probe biomaRt ASSIGN

updated 15.5 years ago • Sergii Ivakhno

designed Agilent array (their 8 x 60K platform). When I compare control samples to treated ones most (i.e. >80%) of the differentially expressed transcripts are up-regulated. This pronounced up-regulation is independent

Microarray Normalization vsn limma siggenes Microarray Normalization vsn limma siggenes

updated 13.1 years ago • Peter Davidsen

in RNA stability between WT and KO cells. The issue that I have run into is that it looks like some genes are stabilized and some genes are destabilized. However, I think this is just due to the relative nature of RNA-seq where...once some genes are stabilized, other genes now take up less of the sequencing pool so look destabilized. I have validated with an alternative...low throughput method ba…

limma voom rnaseq

updated 7.9 years ago • Jake

and collaborative biomedical research projects and activities ranging from analysis of next-gen sequencing data to developing novel statistical/machine learning computational methods. For the overview of the activities...within the laboratory, please visit http://BayesianGenomics.org . Initial salary and the exact nature of the positions will depend on the qualifications of the candidate. Qualif…

Sequencing Microarray Sequencing Microarray

updated 14.2 years ago • Medvedovic, Mario medvedm

stat.ethz.ch/pipermail/bioconductor/2011-March/038134.html [Bioc-sig-seq] Extract masked sequences - https://stat.ethz.ch/pipermail/bioc-sig- sequencing/2010-January/000786.html I have cc:ed the original discussants...getSeqHardMasked <- function(BSg,GR,maskList,letter) { ### PURPOSE: return list of DNAString sequences extracted from the ### BSgenome <bsg> corresponding to…

GO BSgenome BSgenome GO BSgenome BSgenome

updated 14.3 years ago • Malcolm Cook

Hi! I'm using tximport to summarize transcript-level abundance to get gene-level abundance. I didn't specify a value to 'abundanceCol', and I got an abundance matrix in the result. I

tximportData

updated 5 months ago • Jinghua