Bioconductor Forum

vs baseline, and then comparing each of these subsets to each other using GSEA? Or should I deseq2 using the LRT within each infection (so infection 1 -- 0, 12, 24, 48hrs

deseq2 timepoints

updated 4.7 years ago • ayy2110

I am trying to understand exactly what DESeq2's `` resultsNames `` outputs. The documentation says: <pre> resultsNames returns the names of the estimated effects

deseq deseq2

updated 10.9 years ago • igor

slightly different than the usual, but I would like to take advantage of the optimal design of DESeq2, so I wonder whether it would be possible to apply it (and how). I have a counts table with columns as different conditions...after correcting by the previous distribution in the pool. Would that be possible to do with DESeq2? I could do it manually but then I wouldn't know how to apply valuable …

deseq2

updated 6.3 years ago • yermatudela

I was trying to plot PCA using DESeq2 `plotPCA` function and `prcomp` function. However, the variances I obtained was quite different. Why is this? ![prcomp PCA...1] ![DESeq2 PCA][2] **Code for PCA using prcomp:** pca <- prcomp(t(countsPC_batch)) percentage <- round(((pca$sdev^2) / (sum(pca$sdev^2))) * 100, 2) pca_data

deseq2 pca hclust

updated 6.2 years ago • ag1805x

Hello all,   I am analyzing an RNAseq with 6 conditions using deseq2. I have 6 biological replicates for control, however for the other 5 conditions (say C1,C2,C3,C4,C5) I have no replicates

deseq2 differential gene expression

updated 10.2 years ago • ea1402

vs controls) as well as a continuous trait.  While I know that the former can be implemented in DESeq2, I’m not sure whether the latter can; can you comment on this?  If continuous traits can be analyzed, can you provide

deseq2

updated 10.3 years ago • marcus.pezzolesi

I installed Ubuntu 20.04 and R 4.0.1 and I can't install `DESeq2` package. I installed BiocManger using: ``` if (!requireNamespace("BiocManager", quietly = TRUE)) install.packages("BiocManager...BiocManager::install(version = "3.11") ``` When I tried to install `DESeq2` in `Rstudio`, almost all dependencies failed to be installed. So, I opened `R` in the terminal using ` sudo R` comma…

deseq2 install r4.0 bioconductor3.11 ubuntu20.04

updated 5.6 years ago • ruwaa.ibrahem

the limma gene set tests such as camera, romer etc to my RNAseq dataset which I have analysed in DESeq2.  Am I right in thinking that the rlog transformed counts are the appropriate matrix to pass into these functions...to pass a DGEList object to camera (edgeR::camera.DGEList) so I suppose a feature request for DESeq2 would be something similar, but certainly some guidance in the docume…

deseq2 edger limma romer camera

updated 10.4 years ago • phil.chapman

I follow the tutorial; RNA-Seq differential expression work flow using DESeq2 (http://www.sthda.com/english/wiki/rna-seq-differential-expression-work-flow-using-deseq2). I've got stuck below; Could...FALSE, ignore.strand=TRUE, fragments=TRUE ) Error: BiocParallel errors element index: 1, 2, 3 first error: sequences 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19…

deseq2

updated 7.7 years ago • krwyaong.ju

early maturation to dry seed) on a non-model plant species, and used the Salmon -> tximport -> DESeq2 analysis pipeline. For the most part the leaf data looks pretty good. However, I have come across an interesting issue...when it comes to the dry seed data (last seed time point). Although most genes are not DE (based on DESeq2), the vast, vast majority of reads are mapping to just…

rnaseq deseq2

updated 7.4 years ago • Poikilo

Hello Im trying to do an RNA seq differential expression analysis using DESeq2 by doing a likelihood ratio test The DESeq2 manual states " The likelihood ratio test can be performed by ...providing

deseq2 likelihood ratio rna seq wald test

updated 6.3 years ago • adeler001

I have got an Apple MacBook Air M1 with R version 4.2.2. I installed DESeq2 but I can not run it. How could I resolve this error? I tried run DESeq2 with this code: ```library("DESeq2")``` I got this error: ```Loading...anyMissing, rowMedians Error: package or namespace load failed for ‘DESeq2’ in dyn.load(file, DLLpath = DLLpath, ...): unable to load shared object '/Users/thuso…

DESeq2 apple-m1

updated 3.1 years ago • Norbert

I want to make a clustered heat map for the differentially expressed genes I identified with EdgeR where the batch effect was modeled as an experimental factor. To do this, I used the limma package removeBatchEffect() after TMM-normalization and log2 CPM transformation on...expressed genes I identified with EdgeR where the batch effect was modeled as an experimental factor. To do this, I…

rna-seq edgeR limma removebatcheffect() batch

updated 9.9 years ago • Ekarl2

sorry, 1 character's not alot when you are in a hurry;) 2.Being unsure of how lmFit handles factor c(1,2,3..) vs numeric c(1,2,3..) and thinking this example in the Limma user guide meant -ve numbers could be confused as dye swaps...probably wrongly) the > standard approach > >(equilivent to ANOVA?) is to use a non-numeric factor for the fit. > >However, lm() i…

GO Regression limma GO Regression limma

updated 21.4 years ago • Matthew Hannah

Hi, I used following code for DESeq2 workflow but found some differences in results ``` gse # A SummarizedExperiment-tibble abstraction: 3,532,606 × 30 # Features...using tidybulk ``` da <- gse |> test_differential_abundance(~batch + sex + status, method = "DESeq2") da_res <- da %>% pivot_transcript() # to compare results all.equal(rownames(res), da_res$.fe…

DifferentialExpression DESeq2 tidybulk RNASeq

updated 7 months ago • s.malik

Hi, I have been using DESeq2 to analyze ribosome profiling data with the following formula and normalizing each library type (ribosome fragments...and mRNA input) using separate size factors as suggested by Michael Love in a previous post. <pre> ~ assay + condition + assay:condition sf <- numeric(ncol(dds)) idx1 &lt...the significance of changes in the interaction term, I …

deseq2 linear model ribosome profiling stats

updated 10.4 years ago • Jake

Dear Prof. Love, I was wondering if you could help me with a query about the DESeq2 package in R please. I have sequenced RNA transcripts from six separate species and am comparing gene expression...Dear Prof. Love, I was wondering if you could help me with a query about the DESeq2 package in R please. I have sequenced RNA transcripts from six separate species and am comparing gene ex…

Normalization DESeq2

updated 2.2 years ago • cm15245

sampleTable, directory = directory, design=~condition) #ddsHTSeq colData(ddsHTSeq)$condition<-factor(colData(ddsHTSeq)$condition, levels=c('control','test')) dds<-DESeq(ddsHTSeq) res<-results(dds) res<-res[order(res$padj

deseq2 MA

updated 8.6 years ago • niu.shengyong

I would like to ask for your help. I want to perform the deferential expression analysis using the DESeq2 package. I want to compare the expression of smallRNAs in three treated samples vs three control samples. I have the...raw_count TTTGGATTGAAGGGAGCTCTA 59493 Could you tell me how to prepare the file (dds) for the DESeq2 analysis

DESeq2

updated 5.2 years ago • ania.karwot

extracted the protein coding genes from the matrix . However,  the default method for size factor estimation returns NULL.  At the begging I thought it is because my median counts is 0 so geom mean would not work...estimator iterates between estimating the dispersion with a design of ~1, and finding a size factor vector by numerically optimizing the likelihood of the ~1 model" ,…

deseq2 estimatesizefactors

updated 8.1 years ago • Lauma R

I am using, but I was curious to hear if anyone has thoughts on using pseudo-alignment (Salmon) and DESeq2 for this. The workflow I've tried is as follows: 1) Map reads to the model organism that was used in the experiment and extract...prospective species ids for each contig. Then make a contig-to-species map to use with tximport and DESeq2 such that counts from each contig are combined at th…

salmon deseq2

updated 7.0 years ago • kballa

Hello, I'm trying to use DESeq2 to analyze some OTU data from phyloseq and despite going through some of the vignettes I'm getting turned around with...to R. I'll provide an example of what my data set is like and what I'm trying to do. It's possible DESeq2 isn't appropriate for my analyses, but it seems like it should be. Is there a table somewhere that clearly lays out: Test...samples, or if th…

deseq2 phyloseq multiple factor design paired samples

updated 9.8 years ago • pete_bioinfo

group_1 (n=275); group_2 (n=76); group_3 (n=151); group_4 (n=163) and group_5 (n=96). The use of DESeq2 and edgeR gives similar results, with a large number of differentially expressed genes (adjusted P-value <0.05) when...factor levels are compared pairwise, representing about 40-50% of the genes in the whole dataset (which is too many for the phenotype...for large samples due to speed pr…

edgeR DESeq2

updated 2.5 years ago • Luca

Dear list, I have the following affymetrix microarray experiment: 2 fixed effects, each factor has two levels 1 random effect (patient) Can anybody tell me how to calculate the sample size for it? Thanks, Shirley </div

Microarray Microarray

updated 16.7 years ago • shirley zhang

I am trying to use DESeq2 to compare the effect of a treatment between males and females. I have paired samples, and my colData looks as such: &nbsp...nbsp; Is this necessary, or have I been misinterpreting what I'm reading? Should I stick with the first or second design? Any and all help is much appreciated.   Thanks, Greg

deseq2 multiple factor design paired samples

updated 8.9 years ago • gregory.l.stone

submitters care about what's going on in the mouse genes. Should I put mouse and human counts into DESeq2?  Or just human counts?&nbsp

deseq2

updated 7.1 years ago • swbarnes2

does the variance of gene expression (level of disregulation) change across the groups. I know that DeSeq2 calculates a gene-wise diserpersion estimate. Does anyone have any ideas to use this to calculate a sample dispersion

deseq2

updated 9.9 years ago • green.rebeccam

Hi, I'm using DESeq2 with 4 multiple conditions ("A", "B", "C" and "D"), but I'm **only** interested in the comparisons A vs C; A vs D; B vs C and B vs D. Since the higher

deseq2

updated 6.6 years ago • domenicoalessandrosilvestris

two unrelated controls. So overall I am dealing with *n* condition + *n*+2 controls. From the DESeq2 Vignette I could read that a paired experiment should be modeled as ~subject+condition, but I am wondering if this could

deseq2

updated 6.9 years ago • guidobarzaghi

Hi all,     I'm trying to normalize my Illumina MiSeq data using Phyloseq and DESeq2. I want to look at the interactions between my site location and by date. I attempted to use the following command: Laurendds

deseq2 phyloseq

updated 10.9 years ago • locon833

dxd, fitExpToVar="Age", >>> BPPARAM=BPPARAM) >> Error: 8346 errors; first error: >> Error in FUN(1:3[[1L]], ...): Non-factor in model frame >> >> For more information, use bplasterror(). To resume calculation...the argument 'BPRESUME' to TRUE or wrap the >> previous call in bpresume(). >> …

RNASeq TimeCourse timecourse DEXSeq DESeq2 RNASeq TimeCourse timecourse DEXSeq DESeq2

updated 11.4 years ago • Alex Gutteridge

I have obtained intron counts for every intron in all the 6 samples(3,3). My question is can I use deseq2 on this intron count matrix just like we use it on gene counts? Thanks

deseq2 intron differential expression

updated 5.8 years ago • gv

Hi Michael, I am using DESeq2 to do differential analysis for my RNAseq data. I gave raw read count as input and was successful in getting the results

deseq2

updated 7.3 years ago • banerjee.deblina

Is it possible to do a DESeq2 in R out of a .xlsx data? If not, which kind of format do i need? my data is available in the following matrix: gen a... b.. b... patient

deseq2

updated 5.9 years ago • mueslirapper

I am working with DeSeq2 and trying to convert ENSG IDs to Gene symbols after calling the results function in DeSeq2. When doing this however...lt;- mapIds(org.Hs.eg.db, keys=row.names(resultsCtCc), column="SYMBOL", keytype="ENSEMBL", multiVals="first") resultsCtCc.df <- as.data.frame(resultsCtCc) write.csv(resultsGtGc.df, file="/Users/rimlandca/Desktop/R Files/resultsGtGc.csv

deseq2 ensembl

updated 7.9 years ago • casey.rimland

Hello, I need to install an old version of DESeq2 and apeglm from 2019 in order to replicate some old results. I have tried to create a docker image using script below...Hello, I need to install an old version of DESeq2 and apeglm from 2019 in order to replicate some old results. I have tried to create a docker image using script below but DESeq2 does not install. ```r FROM bioconductor…

apeglm Install DESeq2 version

updated 6 months ago • Asma

div class="preformatted">Hi I have a problem on installation of DESeq2 on windows. I use R 3.0.1. After automatically install, I loaded DESeq2, the error message: the package locfit is built...I solve this problems? BTW, automatically installation on R 3.0.2 was not available, I copy the DESeq2 file in the library of R 3.0.1, the same problem appers. Any suggestions are appreciated£¡ Pe…

DESeq2 DESeq2

updated 12.2 years ago • 刘鹏飞

Dear DESeq2 community, I know I can use the rlog or VST (variance stabilized transformed) value from DESeq2 for sample clustering

deseq2

updated 10.8 years ago • Xianjun Dong

Please suggest how to input stringtie reads data for deseq2 analysis

Stringtiereadstodeseq2

updated 3.4 years ago • KMS

Hi there, So, I'm running DESeq2 and have a number of different of different groups (>10) for comparisons. When I reach the prefiltering step, I filter...c("condition", "Condition1", "Condition2"))[filter_assay,] ``` My only question is, does this post-DESeq2 filtering seem appropriate? I worry the significance value is affected by running without pre-filtering removing...the problematic…

filtering DESeq2 outliers

updated 17 months ago • smac97

Hi all, I am trying to install the DESeq2, but I keep getting error message. Here is a code: R version 3.5.1 (2018-07-02) -- "Feather Spray" Copyright (C) 2018 The R Foundation...biocLite.R") Bioconductor version 3.7 (BiocInstaller 1.30.0), ?biocLite for help > biocLite("DESeq2") BioC\_mirror: https://bioconductor.org Using Bioconductor 3.7 (BiocInstaller 1.30.0), R 3.5.1 (2018-07-02…

deseq

updated 7.2 years ago • bikashten

Hi I`m doing differential gene expression analysis with deseq2. The program reports padjusted and log2 fold change between the two groups. I would like to know what is the exact calculation

DESeq2

updated 23 months ago • ilaria.montali

Hi, I'm using DESeq2 for my analysis which is a time-series experiment. How do I fix my desire baseline instead of following DESeq's settings

deseq2

updated 6.2 years ago • kistinamohamed

plot and also on pairwise scatter plot comparison. Can I ignore this one replicate and perform the deseq2 analysis. I understand that the tool will allow and it will loose the statistical power, but my question is does this

deseq2

updated 11.1 years ago • Prasad Siddavatam

create a supervised heatmap for the differential expression data obtained from rnaseq analysis using deseq2.   I'm not able to see the up and down genes cluster  expression  even if I plot only differential expresion

deseq2 supervised

updated 10.8 years ago • aristotele_m

I have four genes in four rows in a matrix. The `` results `` function of the DESeq2 calculated the baseMean of the four row as <pre> 37.6, 2071.5, 1.0, 491.6</pre> But if I calculate the means with rowMeans...I have four genes in four rows in a matrix. The `` results `` function of the DESeq2 calculated the baseMean of the four row as <pre> 37.6, 2071.5, 1.0, 491.6</pre…

deseq2 mean

updated 8.8 years ago • asd

Hi, Wondering how I can modify the following DESeq2 design to extract subcategories, for instance binding events differentially enriched in __only__ Male

deseq2 deseq differential binding analysis

updated 8.1 years ago • rbronste

points (PRE AND POST) . Simply i have 4 groups Pre , Post Low diet, pre and post high diet. i used deseq2  using this code  ddsTC <- DESeqDataSetFromMatrix(countDatanew, colData=phenotype\_data, ~ intervention

deseq2 within-pair analysis

updated 7.3 years ago • frimz.r

Forgive me if this post is messy, I'm new to this! I'm analyzing RNA Seq data and found that one of my samples is an outlier (sample AV17). I'm trying to exclude it from my analysis, but whenever I do, using this code: dds = subset(countData, select = -c(AV17) ), it works, but then when I run the next line dds$condition <- relevel(dds$condition, ref = "CNTRL_WD") it fails and says "dds$c…

DESeq2

updated 23 months ago • amv112

star aligned bam using htseq and following the best practices to do differential expression using DESeq2. Here is my sample information with condition & batch columns Sample condition batch sample_6M_C1 sample_6M_C...sample_5D_M B4 sample_5D_M2 sample_5D_M B4 sample_5D_M3 sample_5D_M B4 And when i run DESeq2 it is giving the below error ddsHTSeq <…

deseq2

updated 5.7 years ago • vrehaman

The DESeq2 workflow calculates a Wald Statistics to then be compared against a normal distribution. Right now I am working with...3 for each condition, unmatched), and I think the picture would be more clear if I could somehow ask DESeq2 to compare the Wald Statistic to a t-distribution with the appropriate number of degrees of freedom. Am I correct that

DESeq2

updated 3.7 years ago • jjeang

Dear all, Depending on the normalization approach (none, quantile, TMM  or DESeq2) applied to the limma-voom function, the number of surrogate variables found by SVA and number of differentially...step? For example, if the RNA-seq samples have different sequencing depths, is this a technical factor that SVA corrects for? Thanks

normalization sva limma-voom

updated 8.5 years ago • aec

Just a very very odd question. I have finished a differential gene expression analysis using the DESeq2 package. I got my list of DEGs, foldchanges, volcano plots etc. Now I have a major headache: __How to present about how DESeq2

deseq2

updated 8.7 years ago • wanziyi89

Hello, I am trying to run Deseq2 on some code, but I seem to be having trouble when I run Deseq2, the error I get is "renaming the first element in assays to

DESeq2

updated 2.9 years ago • wgodfre1

Hi People, I am Marcelo and I live in Brazil. Its possible to analyse my datas in bioconductor R package? I have a MacroArray cDNA whith 3840 genes. My experiments: line suscetible control line suscetible treated line resistant control line resistant treated I search in the site of the project, but I was not capable to find the document that I need. Thanks very much Marcelo ---

updated 22.5 years ago • Marcelo Luiz de Laia

Well that took less time than I thought. We have started to get subscription requests for the mailing list and we need to deal with how to handle contributed libraries. My proposal is to set up a discussion mailing list (that we all subscribe to) for Bioconductor. I don't think that we have anything to discuss yet -- which is a problem. We have had four requests to join all with .de suffixes but…

GO GO

updated 24.1 years ago • rgentleman

Hello, I need to use DESeq2 for a series of simulations on a high-performance computing cluster, but the most recent version of R available is...Hello, I need to use DESeq2 for a series of simulations on a high-performance computing cluster, but the most recent version of R available is 4.0.3...This means I can only use Bioconductor 3.12, and when I go to install DESeq2 using ``` BiocMan…

DESeq2 BiocVersion

updated 4.5 years ago • Daisy

BiocParallel errors 1 remote errors, element index: 1 0 unevaluated and other errors first remote error: Error in DataFrame(..., check.names = FALSE): different row counts implied by arguments while executing the...look like this: > results 8 Samples, 9041 sites in matrix: ID Tissue Factor Condition Treatment Replicate Reads …

BiocParallel DiffBind

updated 7 months ago • this_is_me_trying

Hi I have a question about the use of the contrast of DESeq2. If I have 3 (or more) conditions: A, B and C and I want to do: A vs C and B vs C I can create a table with the columns A B C and to use...Hi I have a question about the use of the contrast of DESeq2. If I have 3 (or more) conditions: A, B and C and I want to do: A vs C and B vs C I can create a table with the columns A B C and to u…

deseq2

updated 10.0 years ago • ribioinfo

Hi all, I am still new to RNA-seq analysis. I understand DESeq2 offer rlog() and vst() as a normalization method to raw count data before running downstream analysis. I just came across...of the different normalization methods offered by these 2 packages? It seems rlog() and vst() from DESeq2 are much simpler than the options offered by _TCGAanalyze\_Normalization(), _but do the…

normalization rnaseq deseq2

updated 7.9 years ago • array chip