of the following skills and experience:
- Work well in team environments; strong communication/organization skills; detail-oriented
- Strong programming experience (R, Python, Matlab, Java, C/C++, Perl or other languages for
Order by: Relevance
of the following skills and experience:
- Work well in team environments; strong communication/organization skills; detail-oriented
- Strong programming experience (R, Python, Matlab, Java, C/C++, Perl or other languages for
updated 5.8 years ago • Fred Hutch (Recruiting)
gt; virus (SFFV) proviral integ
> ration oncogene spi1
> (longDescription available)
> organism: Human,Mouse,Rat,Dog
> pubMedIds:
> urls: msigdb_v2.5.xml
> contributor: Xiaohui Xie
> setVersion: 0.0.1
> creationDate
updated 17.1 years ago • Paul Geeleher
is 20%, stilgthly higher than a typical size
for a
laboratory experiment with a cell line or a model organism.
et <- exactTest(RG, pair=c("planktonic","biofilm"),dispersion=bcv^2) #
exactTest. dispersion = 0.04
et
class(et)
top <- topTags
Description:Full genome sequences for Solanmum lycopersicum provided by ensembl
Version:1.0
organism:Solanum lycopersicum
common_name:Tomato
provider:ensembl
provider_version:Heinz1706
release_date:Jan.2016
mailto:nturaga1 at="" jhmi.edu="">",biocViews =
>"DNAMethylation",genomebuild = "NCBI Build 36",organism =
"Human",species
>= "Homo Sapiens")
> makePdInfoPackage(pkg,destDir=".")
======================================================================
=====
=====
Building annotation package for Nimblegen Tiling
updated 12.5 years ago • Nitesh Turaga
Hello, everyone!
1.
I got the error ___'Error in if (abs(max.ES) > abs(min.ES)) { : ___
___missing value where TRUE/FALSE needed' ___
when running gseaplot() to visualize the GSEA result.
2.
I run the code '_gseaplot(gsea, geneSetID = "mmu03013")' _where gsea is a__ gseaResult__ object. The class of …
updated 8.3 years ago • giuseppe0525
is 20%, stilgthly higher than a typical size
for a
laboratory experiment with a cell line or a model organism.
et <- exactTest(RG, pair=c("planktonic","biofilm"),dispersion=bcv^2) #
exactTest. dispersion = 0.04
et
class(et)
top <- topTags
for KEGG enrichment analysis.
Now I would like to use it for GO enrichment analysis. Since the organism I am working witch is not supported I need to build my own GO mapping and tried to do that by usingthe buildGOmap
updated 9.3 years ago • Marcus
to be susceptible to tumours. They were sacrificed, then tumours and normal tissue from the same organ as tumour were removed. So the metadata I have is:
<pre>
>conds
sampleID Tissue Individual Diet
1 S1 Normal 1 NC
2 S2 Tumour
updated 7.3 years ago • bruce.moran
Dear Gabe,
thanks a lot for making the `` genbankr `` package available. Today, I tried to parse a genbank entry for a synthetic DNA molecule, e.g. [KR709867.1](https://www.ncbi.nlm.nih.gov/nuccore/KR709867.1).
Importing this file by accession failed:
<pre>
id = GBAccession("KR709867.1")
readGenBank(id)
Error in .normargIsCircular(isCircular, seqnames) :
length of suppl…
updated 9.2 years ago • Thomas Sandmann
<div class="preformatted">Bioconductors:
We are pleased to announce the release of Bioconductor 2.3. This
release
includes 36 new software packages, and many changes to existing
packages. Bioconductor 2.3 is comprised of 294 software packages and
is
compatible with the recently released R 2.8.0.
Please visit http://bioconductor.org for details and downloads.
IMPORTANT NOTE FOR MAC USERS:…
updated 17.3 years ago • Patrick Aboyoun
<div class="preformatted">Dear Joern,
I decided to follow your suggestion, and I am trying to use girafe. As
the
alignment file that I have as one line for each hit, I have prepared
another
file which has an extra column which is the number of matches and only
has
one row for each sequence.
V1 V2 V3 V4 V5 V6 V7 V8 V9
1 TTTCTAATGAGCCCAGGGAGGGCTAGA 27 + 5 43076512 43076…
updated 15.7 years ago • Andreia Fonseca
mustWork=TRUE)
## Make and export BSgenome object.
bsgenome <- BSgenome(
organism="Oryza sativa indica",
common_name="rice",
provider="ensembl",
provider_version="v1",
release_date="2011",
release_name
updated 6.5 years ago • bioinagesh
srcUrls = mySrcUrls
> baseMapType = myBaseType
> pkgName = "hsRCv2"
> pkgPath = datadir
> organism = "Homo sapiens"
> version = "1.0.0"
> author = list(author = "Barry Henderson", maintainer =
"barry.henderson at ribonomics.com...mySrcUrls["UG"], parser = file.path(pkgpath,
+ "scripts", "gbUGParser"), baseFile = baseName,
+ organism = "Homo sapiens", buil…
updated 20.5 years ago • Barry Henderson
coverage plots. Besides, it will be really helpful to have a vignette on dealing with the non-model organism while using Gviz.
```
> sessionInfo( )
R version 4.2.1 (2022-06-23)
Platform: x86_64-pc-linux-gnu (64-bit)
Running under: Ubuntu
updated 3.6 years ago • rohitsatyam102
dataSource="ftp://ftp.ensembl.org/pub/release-96/gtf/homo_sapiens/Homo_sapiens.GRCh38.96.gtf.gz",
organism="Homo sapiens")
k <- keys(Txdb, keytype = "TXNAME")
tx2gene <- select(Txdb, k, "GENEID", "TXNAME")
head(tx2gene)
TXNAME GENEID
1 ENST00000456328
Motivation and goal: To prepare a BSgenome data package for the model organism, Setaria italica. The reason is that one appears to be needed according to section 2.3 of ggbio vignette dated August
2020 [AEHTS] Searching /home/hatta/retina-rnaseq-mouse/reference/reference_genomes/ for supported organisms
Mon Mar 2 14:32:11 2020 [AEHTS] Downloading IDF http://www.ebi.ac.uk/arrayexpress/files/E-MTAB-6071/E-MTAB-6071.idf.txt
updated 6.0 years ago • Ed Siefker
object:
# Db type: TxDb
# Supporting package: GenomicFeatures
# Data source: dmel-all-r6.38.gtf
# Organism: NA
# Taxonomy ID: NA
# miRBase build ID: NA
# Genome: NA
# Nb of transcripts: 35367
# Db created by: GenomicFeatures package from
new subject heading.
In some cases, which include the archiving system, the e-mail client
tries to organize the e-mails by threads. Because some people tend to
change the subject name inside of a thread, there is an additional
updated 19.1 years ago • Francois Pepin
I am trying to make an organism db to use with GoSeq for pancium hallii. Using the biomart package I found what dataset to use but I get the error that...plant I don't see multiple subdirectories. I am not sure how to fix the error.
```
> # make the organism db
> makeOrganismDbFromBiomart(biomart="plants_mart",
+ dataset="phfil2_eg_gene",
+ …
updated 4.7 years ago • Catherine
say <20%) ?
I mean, in cross-species studies, or when comparing different tissues
of
the same organism, if this assumption doesn't hold, should it be a
serious
concern ?
Assaf
On Thu, Aug 28, 2014 at 7:42 PM, Tim Triche, Jr. <tim.triche...a
method
> that might interest others working on non-model or incompletely
annotated
> organisms:
>
> http://genomebiol…
updated 11.5 years ago • assaf www
lt;-txdbmaker::makeTxDbFromGFF("genomic.gff",format="auto",chrominfo=s,dataSource="GCA_007735645.1",organism="Venturia.effusa",taxonomyId=50376,dbxrefTag="GENEID")
int<-GenomicFeatures::intronsByTranscript(tx,use.names
updated 17 months ago • mat149
using gentrome
makeLinkedTxome(indexDir = "salmon_index_loc",
source = "stringtie",
organism = "Homo Sapiens",
release = "102",
genome = "GRCh38",
fasta = "gentrome_fasta_loc",
gtf = "custom_gtf_loc",
write=F)
```
When I try to create
updated 3.6 years ago • jvandinter
makeLinkedTxome(indexDir = index_dir,
source = "Ensembl",
organism = "Danio rerio",
release = "104",
genome = "GRCz11",
fasta = fasta_url,
gtf = gtf_url)
```
I needed to make the coldata for tximeta to act
updated 4.3 years ago • alex.weiss
p>
<h2>Description</h2>
<p>Exploratory Statistics is part of the Data and Statistical Sciences (DSS) organization in AbbVie R&D. This group provides statistical expertise globally for various groups in drug discovery
updated 11.0 years ago • Feng Hong
gt;>> names for Arabidopsis thaliana using our internal "orgid" filter
for
>>> organism ID 167:
>>>
>>> > library('biomaRt')
>>> > phyto=useMart('phytozome_mart', dataset='phytozome')
>>> > transcripts
updated 14.4 years ago • Richard Hayes
<div class="preformatted">Simon No?l <simon.noel.2 ...="" at=""> writes:
>
> Hi,
>
> There is my understanting of the situation
>
> In DNA, there are some time ambiguities in nucleic acide sequence.
Because an
aa may have many codon,
> sometime swiching an A for a C for exemple won't do any big
difference. That
where ambiguities lette…
updated 14.9 years ago • li lilingdu
Locus ID Chromosome ID
GenBank
accession number Tissue Gene map Gene name
Organism Sequence Detection
Method (w595) Detection Method (w685) Detection Status (w595)
Detection
Status (w685) X Centroid
updated 20.4 years ago • Susan J. Miller
<div class="preformatted">
Hi,
Here is an update of information on the BioConductor Developer
Workshop, to be
held in Lausanne, Switzerland on 24-25 April 2008. If you have
already
registered, you should receive an email with this information, please
let me
know if you did not get it. The most up to date information is on the
wiki page
http://wiki.fhcrc.org/bioc/Lausanne_Dev_Meeting_2008…
updated 18.0 years ago • Darlene Goldstein
Data source: /s4s/s4s\_nathan\_lawson/SC3primeSeq/ENSEMBLchrExt.v14.no.rRNA.gtf
\# Organism: NA
\# Taxonomy ID: NA
\# miRBase build ID: NA
\# Genome: NA
\# transcript\_nrow: 54275
\# exon\_nrow: 333697
\# cds\_nrow: 271232
\# Db created
updated 9.3 years ago • Julie Zhu
package: GenomicFeatures
| Data source:
ftp://ftp.ncbi.nlm.nih.gov/genomes/Cricetulus_griseus/GFF/
| Organism: Cricetulus griseus
| miRBase build ID: NA
| transcript_nrow: 21612
| exon_nrow: 212163
| cds_nrow: 183531
| Db created by
updated 12.5 years ago • Guido Hooiveld
result of adj.P.Value < 0.001.
res<-spia(de=DE\_malus, all=entrez\_only, organism="mdm", nB = 2000, pathids = NULL, data.dir="./", combine = 'fisher', plots = TRUE)
Done pathway 1 : RNA transport
updated 9.2 years ago • theobroma22
it would be a mapping between Entrez
Gene IDs
>>>> and miRNA families, for a couple of organisms, together with some
>>>> additional info or course.
>>>>
>>>> I am trying to make use of the AnnBuilder
updated 17.0 years ago • Gábor Csárdi
gt; biocViews = "AnnotationData",
> genomebuild = "hg19",
> organism = "Human", species = "Homo Sapiens",
> pgfFile=pgfFile,
> clfFile=clfFile,
> probeFile=probeFile,
> transFile=transFile
updated 14.7 years ago • Maria Rodrigo-Domingo / Region Nordjyll…
Db type: TxDb
# Supporting package: GenomicFeatures
# Data source: dmel-all-r6.38.gtf.gz
# Organism: NA
# Taxonomy ID: NA
# miRBase build ID: NA
# Genome: NA
# Nb of transcripts: 35367
# Db created by: GenomicFeatures package from
Hi all,
I have recently posted an Rsubread featurecounts related question, but I have another one, based on a quality control analysis I would like to do:
I am attempting to identify a fluorescent reporter that is driven of a specific promoter in our cells of interest which we then sort (based on fluorescence) and sequence. The fluorescent reporter is ZsG. I cannot find a de…
RSQLite version at creation time: 0.11.1
| DBSCHEMAVERSION: 1.0
> Athaliana
Arabidopsis genome
|
| organism: Arabidopsis thaliana (Arabidopsis)
| provider: TAIR
| provider version: 04232008
| release date: NA
| release name: dumped
updated 13.4 years ago • sun
steps:
>
> library(KEGGgraph)
> filename <- "hsa00260.kgml"
> retrieveKGML("00260", organism="hsa", destfile=filename, method =
> "internal")
> pathway <- parseKGML(filename)
>
> g.reaction <- KEGGpathway2reactionGraph
disappointed to see
that
>>it was
>>so much more easy to do certain things with other organisms/other
chips.
>>i hadn't realized coli was so out of fashion in labs that afford
many chips.
>>about the bimodality
updated 19.8 years ago • Jenny Drnevich
BSgenome.Drerio.UCSC.danRer5)
>>> Drerio
>> Zebrafish genome
>> |
>> | organism: Danio rerio (Zebrafish)
>> | provider: UCSC
>> | provider version: danRer5
>> | release date: Jul. 2007
>> | release
updated 16.6 years ago • Hervé Pagès
nbsp; = FALSE)</code>
Output 1
<code>#<br/>
# Gene Set Enrichment Analysis<br/>
#<br/>
#...@organism Homo sapiens<br/>
#...@setType CC<br/>
#...@keytype ENTREZID<br/>
#...@geneList...79682/57"| __truncated__ ...&l…
updated 4.9 years ago • ssv
TRUE)
kegg_organism = "hsa"
set.seed(1234)
kk2 <- gseKEGG(geneList = kegg_gene_list,
organism = kegg_organism,
nPerm = 10000,
minGSSize = 3,
maxGSSize = 800,
pvalueCutoff = 0.05,
pAdjustMethod = "none",
keyType = "ncbi-geneid
updated 2.9 years ago • m-bihie
bamFlsR <- sample.inform[, "bamfile_resort"]
c_ers <- easyRNASeq(organism = "Dmelanogaster",
chr.sizes = as.list(seqlengths(Dmelanogaster)),
annotationMethod = "gtf", annotationFile= gtf,
format
updated 13.5 years ago • Mark Robinson
<div class="preformatted">Hi Roy-
First, I am obliged to discourage you from doing this type of analysis
without replicates, for two reasons: 1) it is not good science, as
biological and experimental variability is high in these types of
experiments, and your samples may not be representative; and 2)
because
the statistical techniques that DiffBind relies on (embodied in the
edgeR,
DESeq, …
TRUE)
kegg_organism = "hsa"
set.seed(1234)
kk2 <- gseKEGG(geneList = kegg_gene_list,
organism = kegg_organism,
nPerm = 10000,
minGSSize = 3,
maxGSSize = 800,
pvalueCutoff = 0.05,
pAdjustMethod = "none",
keyType = "ncbi-geneid
updated 2.9 years ago • m-bihie
ended up a lot of effective shifts for Calgary major towards their objective, as shown through Organic and natural Stat Trick Gameflow chart. Individuals methods down had been the Flames knocking upon the doorway just
updated 23 months ago • Gp.dispoz
On 19 Aug 2009, at 20:32, Alex Sanchez wrote:
> Hello
>
> goProfiles works with 'organism' anotation packages
('org.XXX.XXX.db')
> There is an Arabidopsis annotation package 'org.At.tair.db' in the
> next
updated 16.5 years ago • Johannes Hanson
indeed a problem I didn?t
> realize previously! KEGG uses Entrez Gene ID for all other
> model organisms I?ve checked.
> I am working on a generic fix (not only for E coli but
> other
> species with similar situation) and
invalid names for slots of class "GOHyperGResult": pvalues,
oddsRatios, expectedCounts, catToGeneId, organism
> ########
>
> I'm confused about this problem. SessionInfo for both is the same.
>
> R version 2.10.0 (2009-10-26)
> i386-pc
symposium run by volunteers, and
could not survive without the financial support of authors and
organizers alike.
======================================================================
==
Organizers
----------------------------------------------------------------------
--
General Symposium Chair
Daniel Keim, University of Konstanz, Germany, keim@fmi.uni-
konstanz.de
updated 23.1 years ago • rgentleman
gt;
> makeLinkedTxome(indexDir=indexDir,
+ source="LocalEnsembl", organism="Mus musculus",
+ release="102", genome="GRCm38",
+ fasta=fastaFTP, gtf=gtfFTP)
writing linkedTxome to /Users/hinmanmak/Library
updated 2.3 years ago • kyliecode
<div class="preformatted">
Hi Ivan,
I also post this to bioconductor mailing list because the mailing list
is
archived regularly and other users can search the archive to get
useful
information.
There are some approaches you can try to see what happened here:
1) Make sure there is no extra space on your basefile. (check
probes 108179, 108184, 108185, 108195, ect)
2)
How did you create…
updated 20.4 years ago • Ting-Yuan Liu FHCRC
G]{6}\\.bam$",
+ format="bam",
+ readLength=36L,
+ organism="Dmelanogaster",
+
chr.sizes=as.list(seqlengths(Dmelanogaster)),
+ annotationMethod="rda",
+ annotationFile=system.file
updated 13.6 years ago • Richard Friedman
Ochogaster (NCBI version GCF_000317375.1_MicOch1.0) and stored in Biostrings objects.
Version: 1.0
organism: Microtus Ochrogaster
common_name: Prairie Vole
provider: NCBI
provider_version: MicOch1.0
release_date: July
pkgPath="C:/Documents and
Settings/cmetcs/Desktop/data/cellminer/both/data/annotation",
organism="Homo sapiens", version="1.1.0",
author=list(author="Chuen Seng",maintainer
="chuenseng.tan at ki.se"),
fromWeb = TRUE)
#############################
#These
updated 18.7 years ago • Chuen Seng, Tan
size 200). I used the [information here][1] and [here][2] to make a custom annotation list from my organisms .gff file and that appears to work.
txdb <- GenomicFeatures::makeTxDbFromGFF("20181113_hcah_GCF_000223905.1_ASM22390v1_genomic.gff
updated 6.5 years ago • ryleehackley
get(ls(paste("package:",BSgenome, sep="")))
Black cottonwood genome
|
| organism: Populus trichocarpa (Black cottonwood)
| provider: Phytozome (JGI)
| provider version: 3.0
| release date: January 2010...Ptrichocarpa"
get(ls("package:BSgenome.Ptrichocarpa.Phytozome.v3"))
Black cottonwood genome
|
| organism: Populus trichocarpa (Black cottonwood)
| provider: Phytozome (JGI)
| provider version: 3.…
all these aspects and allow different steps to load
data,
> corresponding to the level of data organization, GSM to GPL,
converting them
> in ExpressionSet type.
>
Hi, Alex.
Your understanding is correct. GSE and GDS contain
updated 15.5 years ago • Sean Davis
Recent ...
Replies
Comment: Can sample-level weights be used when analysing GSVA scores in limma?
by
A.Barden
▴
20
Thanks both for this useful information.
Comment: Reproducibility of code in various Bioconductor versions
by
Gordon Smyth
53k
SNPlocs.Hsapiens.dbSNP155.GRCh38 is available for download from the same location as always. It has not changed since Bioc 3.20:
Presumabl…
Comment: Changing multiple display parameters of a specific exon in GeneRegionTrack
by
a2a2hd42aa
•
0
Similarly, for structural complexity in the [He777 Game][1] APK, having precise control over every detail is what makes a high-performance …
Answer: Issue loading and downloading Bioconductor 3.22 packages after update
by
strawberry3
•
0
Hi, thank you all for the advice.
Using James's advice, I managed to install SNPlocs.Hsapiens.dbSNP155.GRCh38, but it took almost half an …
Answer: Issue loading and downloading Bioconductor 3.22 packages after update
by
James W. MacDonald
68k
As Robert and ATpoint have mentioned, you need to allow more time to download a large file like this.
```
> options(timeout = 5e5)
> l…
Votes
Awards
• All
Popular Question to
Jaqueline
•
0
Scholar to
Gordon Smyth
53k
Popular Question to
Dario Strbenac
★
1.6k
Popular Question to
chirag.parsania
▴
10
Popular Question to
Michael Love
43k
Locations
• All
Chile, 18 minutes ago
Barcelona, Spain, 27 minutes ago
Iran, 42 minutes ago
United States, 55 minutes ago
United States, 1 hour ago
Chile, 18 minutes ago
Barcelona, Spain, 27 minutes ago
Iran, 42 minutes ago
United States, 55 minutes ago
United States, 1 hour ago
Traffic: 1225 users visited in the last hour
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by the
version 2.3.6
version 2.3.6