Bioconductor Forum

of the following skills and experience: - Work well in team environments; strong communication/organization skills; detail-oriented - Strong programming experience (R, Python, Matlab, Java, C/C++, Perl or other languages for

genomics seattle bioinformatics data science statistics Job

updated 5.6 years ago • Fred Hutch (Recruiting)

gt; virus (SFFV) proviral integ > ration oncogene spi1 > (longDescription available) > organism: Human,Mouse,Rat,Dog > pubMedIds: > urls: msigdb_v2.5.xml > contributor: Xiaohui Xie > setVersion: 0.0.1 > creationDate

Transcription Annotation Pathways Infrastructure probe convert GSEABase Transcription

updated 16.9 years ago • Paul Geeleher

is 20%, stilgthly higher than a typical size for a laboratory experiment with a cell line or a model organism. et <- exactTest(RG, pair=c("planktonic","biofilm"),dispersion=bcv^2) # exactTest. dispersion = 0.04 et class(et) top <- topTags

Alignment Organism topGO edgeR Alignment Organism topGO edgeR

updated 11.7 years ago • biotech

Description:Full genome sequences for Solanmum lycopersicum provided by ensembl Version:1.0 organism:Solanum lycopersicum common_name:Tomato provider:ensembl provider_version:Heinz1706 release_date:Jan.2016

bsgenome txdb promoter

updated 9.9 years ago • sekawaiwai2006

mailto:nturaga1 at="" jhmi.edu="">",biocViews = >"DNAMethylation",genomebuild = "NCBI Build 36",organism = "Human",species >= "Homo Sapiens") > makePdInfoPackage(pkg,destDir=".") ====================================================================== ===== ===== Building annotation package for Nimblegen Tiling

Annotation PROcess pdInfoBuilder charm Annotation PROcess pdInfoBuilder charm

updated 12.4 years ago • Nitesh Turaga

Hello, everyone! 1. I got the error ___'Error in if (abs(max.ES) > abs(min.ES)) { :  ___ ___missing value where TRUE/FALSE needed' ___ when running gseaplot() to visualize the GSEA result.   2. I run the code '_gseaplot(gsea, geneSetID = "mmu03013")'  _where gsea is a__ gseaResult__ object. The class of&nbsp…

gsea clusterprofiler

updated 8.1 years ago • giuseppe0525

is 20%, stilgthly higher than a typical size for a laboratory experiment with a cell line or a model organism. et <- exactTest(RG, pair=c("planktonic","biofilm"),dispersion=bcv^2) # exactTest. dispersion = 0.04 et class(et) top <- topTags

Alignment Organism topGO edgeR Alignment Organism topGO edgeR

updated 11.7 years ago • biotech

for KEGG enrichment analysis. Now I would like to use it for GO enrichment analysis. Since the organism I am working witch is not supported I need to build my own GO mapping  and tried to do that by usingthe buildGOmap

clusterprofiler

updated 9.1 years ago • Marcus

to be susceptible to tumours. They were sacrificed, then tumours and normal tissue from the same organ as tumour were removed. So the metadata I have is: <pre> >conds sampleID Tissue Individual Diet 1 S1 Normal 1 NC 2 S2 Tumour

DESeq2 design and contrast matrix

updated 7.1 years ago • bruce.moran

Dear Gabe, thanks a lot for making the `` genbankr `` package available. Today, I tried to parse a genbank entry for a synthetic DNA molecule, e.g. [KR709867.1](https://www.ncbi.nlm.nih.gov/nuccore/KR709867.1). Importing this file by accession failed: <pre> id = GBAccession("KR709867.1") readGenBank(id) Error in .normargIsCircular(isCircular, seqnames) : length of suppl…

genbankr

updated 9.1 years ago • Thomas Sandmann

<div class="preformatted">Bioconductors: We are pleased to announce the release of Bioconductor 2.3. This release includes 36 new software packages, and many changes to existing packages. Bioconductor 2.3 is comprised of 294 software packages and is compatible with the recently released R 2.8.0. Please visit http://bioconductor.org for details and downloads. IMPORTANT NOTE FOR MAC USERS:…

aCGH Sequencing miRNA Microarray Visualization Bayesian Classification Survival Yeast LPE

updated 17.2 years ago • Patrick Aboyoun

<div class="preformatted">Dear Joern, I decided to follow your suggestion, and I am trying to use girafe. As the alignment file that I have as one line for each hit, I have prepared another file which has an extra column which is the number of matches and only has one row for each sequence. V1 V2 V3 V4 V5 V6 V7 V8 V9 1 TTTCTAATGAGCCCAGGGAGGGCTAGA 27 + 5 43076512 43076…

Annotation annotate biomaRt IRanges girafe Annotation annotate biomaRt IRanges girafe

updated 15.5 years ago • Andreia Fonseca

mustWork=TRUE) ## Make and export BSgenome object. bsgenome <- BSgenome( organism="Oryza sativa indica", common_name="rice", provider="ensembl", provider_version="v1", release_date="2011", release_name

bsgenome forge twobits_export bioconductor

updated 6.4 years ago • bioinagesh

srcUrls = mySrcUrls > baseMapType = myBaseType > pkgName = "hsRCv2" > pkgPath = datadir > organism = "Homo sapiens" > version = "1.0.0" > author = list(author = "Barry Henderson", maintainer = "barry.henderson at ribonomics.com...mySrcUrls["UG"], parser = file.path(pkgpath, + "scripts", "gbUGParser"), baseFile = baseName, + organism = "Homo sapiens", buil…

Annotation GO Cancer Organism Biobase annotate AnnBuilder PROcess Annotation GO Cancer

updated 20.4 years ago • Barry Henderson

coverage plots. Besides, it will be really helpful to have a vignette on dealing with the non-model organism while using Gviz. ``` > sessionInfo( ) R version 4.2.1 (2022-06-23) Platform: x86_64-pc-linux-gnu (64-bit) Running under: Ubuntu

Gviz

updated 3.5 years ago • rohitsatyam102

dataSource="ftp://ftp.ensembl.org/pub/release-96/gtf/homo_sapiens/Homo_sapiens.GRCh38.96.gtf.gz", organism="Homo sapiens") k <- keys(Txdb, keytype = "TXNAME") tx2gene <- select(Txdb, k, "GENEID", "TXNAME") head(tx2gene) TXNAME GENEID 1 ENST00000456328

deseq2 salmon tximport

updated 6.4 years ago • mr6518849

Motivation and goal: To prepare a BSgenome data package for the model organism, Setaria italica. The reason is that one appears to be needed according to section 2.3 of ggbio vignette dated August

bsgenome ggbio

updated 6.2 years ago • pterry

2020 [AEHTS] Searching /home/hatta/retina-rnaseq-mouse/reference/reference_genomes/ for supported organisms Mon Mar 2 14:32:11 2020 [AEHTS] Downloading IDF http://www.ebi.ac.uk/arrayexpress/files/E-MTAB-6071/E-MTAB-6071.idf.txt

software error arrayexpressHTS

updated 5.8 years ago • Ed Siefker

object: # Db type: TxDb # Supporting package: GenomicFeatures # Data source: dmel-all-r6.38.gtf # Organism: NA # Taxonomy ID: NA # miRBase build ID: NA # Genome: NA # Nb of transcripts: 35367 # Db created by: GenomicFeatures package from

Aspli ASpli

updated 4.7 years ago • jbono

new subject heading. In some cases, which include the archiving system, the e-mail client tries to organize the e-mails by threads. Because some people tend to change the subject name inside of a thread, there is an additional

updated 18.9 years ago • Francois Pepin

I am trying to make an organism db to use with GoSeq for pancium hallii. Using the biomart package I found what dataset to use but I get the error that...plant I don't see multiple subdirectories. I am not sure how to fix the error. ``` > # make the organism db > makeOrganismDbFromBiomart(biomart="plants_mart", + dataset="phfil2_eg_gene", + …

FunctionalAnnotation

updated 4.5 years ago • Catherine

say <20%) ? I mean, in cross-species studies, or when comparing different tissues of the same organism, if this assumption doesn't hold, should it be a serious concern ? Assaf On Thu, Aug 28, 2014 at 7:42 PM, Tim Triche, Jr. <tim.triche...a method > that might interest others working on non-model or incompletely annotated > organisms: > > http://genomebiol…

RNASeq Normalization Organism zebrafish edgeR

updated 11.3 years ago • assaf www

lt;-txdbmaker::makeTxDbFromGFF("genomic.gff",format="auto",chrominfo=s,dataSource="GCA_007735645.1",organism="Venturia.effusa",taxonomyId=50376,dbxrefTag="GENEID") int<-GenomicFeatures::intronsByTranscript(tx,use.names

GenomicRanges GenomicFeatures

updated 15 months ago • mat149

using gentrome makeLinkedTxome(indexDir = "salmon_index_loc", source = "stringtie", organism = "Homo Sapiens", release = "102", genome = "GRCh38", fasta = "gentrome_fasta_loc", gtf = "custom_gtf_loc", write=F) ``` When I try to create

swish fishpond GenomicFeatures tximeta

updated 3.4 years ago • jvandinter

makeLinkedTxome(indexDir = index_dir, source = "Ensembl", organism = "Danio rerio", release = "104", genome = "GRCz11", fasta = fasta_url, gtf = gtf_url) ``` I needed to make the coldata for tximeta to act

tximeta SummarizedExperiment DESeq2

updated 4.2 years ago • alex.weiss

p> <h2>Description</h2> <p>Exploratory Statistics is part of the Data and Statistical Sciences (DSS) organization in AbbVie R&D. This group provides statistical expertise globally for various groups in drug discovery

genomics genetics proteomics rnaseq microarray Job

updated 10.8 years ago • Feng Hong

gt;>> names for Arabidopsis thaliana using our internal "orgid" filter for >>> organism ID 167: >>> >>> > library('biomaRt') >>> > phyto=useMart('phytozome_mart', dataset='phytozome') >>> > transcripts

Organism Arabidopsis thaliana biomaRt Organism Arabidopsis thaliana biomaRt

updated 14.2 years ago • Richard Hayes

<div class="preformatted">Simon No?l <simon.noel.2 ...="" at=""> writes: > > Hi, > > There is my understanting of the situation > > In DNA, there are some time ambiguities in nucleic acide sequence. Because an aa may have many codon, > sometime swiching an A for a C for exemple won't do any big difference. That where ambiguities lette…

Organism Biostrings Organism Biostrings

updated 14.8 years ago • li lilingdu

Locus ID Chromosome ID GenBank accession number Tissue Gene map Gene name Organism Sequence Detection Method (w595) Detection Method (w685) Detection Status (w595) Detection Status (w685) X Centroid

Microarray limma Microarray limma

updated 20.2 years ago • Susan J. Miller

<div class="preformatted"> Hi, Here is an update of information on the BioConductor Developer Workshop, to be held in Lausanne, Switzerland on 24-25 April 2008. If you have already registered, you should receive an email with this information, please let me know if you did not get it. The most up to date information is on the wiki page http://wiki.fhcrc.org/bioc/Lausanne_Dev_Meeting_2008…

SNP Annotation annaffy AnnBuilder biomaRt cellHTS2 SNP Annotation annaffy AnnBuilder

updated 17.9 years ago • Darlene Goldstein

Data source: /s4s/s4s\_nathan\_lawson/SC3primeSeq/ENSEMBLchrExt.v14.no.rRNA.gtf \# Organism: NA \# Taxonomy ID: NA \# miRBase build ID: NA \# Genome: NA \# transcript\_nrow: 54275 \# exon\_nrow: 333697 \# cds\_nrow: 271232 \# Db created

genomicfeatures

updated 9.1 years ago • Julie Zhu

GO GenomicFeatures GO GenomicFeatures

updated 12.4 years ago • Guido Hooiveld

result of adj.P.Value < 0.001.      res<-spia(de=DE\_malus, all=entrez\_only, organism="mdm", nB = 2000, pathids = NULL, data.dir="./", combine =         'fisher', plots = TRUE)     Done pathway 1 : RNA transport

SPIA

updated 9.0 years ago • theobroma22

it would be a mapping between Entrez Gene IDs >>>> and miRNA families, for a couple of organisms, together with some >>>> additional info or course. >>>> >>>> I am trying to make use of the AnnBuilder

miRNA Annotation AnnBuilder AnnotationDbi miRNA Annotation AnnBuilder AnnotationDbi

updated 16.8 years ago • Gábor Csárdi

gt; biocViews = "AnnotationData", > genomebuild = "hg19", > organism = "Human", species = "Homo Sapiens", > pgfFile=pgfFile, > clfFile=clfFile, > probeFile=probeFile, > transFile=transFile

BiocViews Annotation Organism cdf biocViews oligo pdInfoBuilder BiocViews BiocViews cdf

updated 14.5 years ago • Maria Rodrigo-Domingo / Region Nordjyll…

Db type: TxDb # Supporting package: GenomicFeatures # Data source: dmel-all-r6.38.gtf.gz # Organism: NA # Taxonomy ID: NA # miRBase build ID: NA # Genome: NA # Nb of transcripts: 35367 # Db created by: GenomicFeatures package from

DRIMSeq DEXSeq

updated 4.7 years ago • jbono

Hi all,  I have recently posted an Rsubread featurecounts related question, but I have another one, based on a quality control analysis I would like to do:  I am attempting to identify a fluorescent reporter that is driven of a specific promoter in our cells of interest which we then sort (based on fluorescence) and sequence. The fluorescent reporter is ZsG. I cannot find a de…

rsubread alignment align

updated 7.1 years ago • A

Annotation Cancer Arabidopsis thaliana BSgenome SNPlocs TranscriptDb BSgenome Annotation

updated 13.2 years ago • sun

steps: > > library(KEGGgraph) > filename <- "hsa00260.kgml" > retrieveKGML("00260", organism="hsa", destfile=filename, method = > "internal") > pathway <- parseKGML(filename) > > g.reaction <- KEGGpathway2reactionGraph

graph KEGGgraph graph KEGGgraph

updated 12.2 years ago • Zhang, Jitao David

disappointed to see that >>it was >>so much more easy to do certain things with other organisms/other chips. >>i hadn't realized coli was so out of fashion in labs that afford many chips. >>about the bimodality

Annotation GO affy Annotation GO affy

updated 19.7 years ago • Jenny Drnevich

Cancer Danio rerio zebrafish Cancer Danio rerio zebrafish

updated 16.4 years ago • Hervé Pagès

nbsp;   = FALSE)</code> Output 1 <code>#<br/> # Gene Set Enrichment Analysis<br/> #<br/> #...@organism    Homo sapiens<br/> #...@setType     CC<br/> #...@keytype     ENTREZID<br/> #...@geneList...79682/57"| __truncated__ ...&l…

clusterprofiler

updated 4.7 years ago • ssv

TRUE) kegg_organism = "hsa" set.seed(1234) kk2 <- gseKEGG(geneList = kegg_gene_list, organism = kegg_organism, nPerm = 10000, minGSSize = 3, maxGSSize = 800, pvalueCutoff = 0.05, pAdjustMethod = "none", keyType = "ncbi-geneid

KEGG clusterProfiler gsean

updated 2.8 years ago • m-bihie

bamFlsR <- sample.inform[, "bamfile_resort"] c_ers <- easyRNASeq(organism = "Dmelanogaster", chr.sizes = as.list(seqlengths(Dmelanogaster)), annotationMethod = "gtf", annotationFile= gtf, format

GO Infrastructure Rsubread easyRNASeq GO Infrastructure Rsubread easyRNASeq

updated 13.3 years ago • Mark Robinson

<div class="preformatted">Hi Roy- First, I am obliged to discourage you from doing this type of analysis without replicates, for two reasons: 1) it is not good science, as biological and experimental variability is high in these types of experiments, and your samples may not be representative; and 2) because the statistical techniques that DiffBind relies on (embodied in the edgeR, DESeq, …

DiffBind DESeq2 DiffBind DESeq2

updated 11.9 years ago • Rory Stark

TRUE) kegg_organism = "hsa" set.seed(1234) kk2 <- gseKEGG(geneList = kegg_gene_list, organism = kegg_organism, nPerm = 10000, minGSSize = 3, maxGSSize = 800, pvalueCutoff = 0.05, pAdjustMethod = "none", keyType = "ncbi-geneid

KEGG clusterProfiler Bioconductor

updated 2.7 years ago • m-bihie

ended up a lot of effective shifts for Calgary major towards their objective, as shown through Organic and natural Stat Trick Gameflow chart. Individuals methods down had been the Flames knocking upon the doorway just

fabia

updated 21 months ago • Gp.dispoz

On 19 Aug 2009, at 20:32, Alex Sanchez wrote: > Hello > > goProfiles works with 'organism' anotation packages ('org.XXX.XXX.db') > There is an Arabidopsis annotation package 'org.At.tair.db' in the > next

Annotation GO topGO goProfiles Annotation GO topGO goProfiles

updated 16.3 years ago • Johannes Hanson

indeed a problem I didn?t > realize previously! KEGG uses Entrez Gene ID for all other > model organisms I?ve checked. > I am working on a generic fix (not only for E coli but > other > species with similar situation) and

PROcess pathview PROcess pathview

updated 12.3 years ago • Oleg Moskvin

invalid names for slots of class "GOHyperGResult": pvalues, oddsRatios, expectedCounts, catToGeneId, organism > ######## > > I'm confused about this problem. SessionInfo for both is the same. > > R version 2.10.0 (2009-10-26) > i386-pc

Annotation GO hgu133a probe GOstats Category Annotation GO hgu133a probe GOstats

updated 16.2 years ago • LIYUN

symposium run by volunteers, and could not survive without the financial support of authors and organizers alike. ====================================================================== == Organizers ---------------------------------------------------------------------- -- General Symposium Chair Daniel Keim, University of Konstanz, Germany, keim@fmi.uni- konstanz.de

Visualization PROcess Category Visualization PROcess Category

updated 22.9 years ago • rgentleman

gt; > makeLinkedTxome(indexDir=indexDir, + source="LocalEnsembl", organism="Mus musculus", + release="102", genome="GRCm38", + fasta=fastaFTP, gtf=gtfFTP) writing linkedTxome to /Users/hinmanmak/Library

tximeta

updated 2.2 years ago • kyliecode

<div class="preformatted"> Hi Ivan, I also post this to bioconductor mailing list because the mailing list is archived regularly and other users can search the archive to get useful information. There are some approaches you can try to see what happened here: 1) Make sure there is no extra space on your basefile. (check probes 108179, 108184, 108185, 108195, ect) 2) How did you create…

Microarray Annotation Cancer probe annotate AnnBuilder Microarray Annotation Cancer probe

updated 20.3 years ago • Ting-Yuan Liu FHCRC

G]{6}\\.bam$", + format="bam", + readLength=36L, + organism="Dmelanogaster", + chr.sizes=as.list(seqlengths(Dmelanogaster)), + annotationMethod="rda", + annotationFile=system.file

RNASeq Annotation GUI Cancer BSgenome BSgenome easyRNASeq RNASeq Annotation GUI Cancer

updated 13.4 years ago • Richard Friedman

Ochogaster (NCBI version GCF_000317375.1_MicOch1.0) and stored in Biostrings objects. Version: 1.0 organism: Microtus Ochrogaster common_name: Prairie Vole provider: NCBI provider_version: MicOch1.0 release_date: July

BSgenome microtus forging

updated 5.1 years ago • A.J.

pkgPath="C:/Documents and Settings/cmetcs/Desktop/data/cellminer/both/data/annotation", organism="Homo sapiens", version="1.1.0", author=list(author="Chuen Seng",maintainer ="chuenseng.tan at ki.se"), fromWeb = TRUE) ############################# #These

Annotation GO probe annotate AnnBuilder Annotation GO probe annotate AnnBuilder

updated 18.5 years ago • Chuen Seng, Tan

size 200). I used the [information here][1] and [here][2] to make a custom annotation list from my organisms .gff file and that appears to work. txdb <- GenomicFeatures::makeTxDbFromGFF("20181113_hcah_GCF_000223905.1_ASM22390v1_genomic.gff

ChIPQC software error

updated 6.3 years ago • ryleehackley

get(ls(paste("package:",BSgenome, sep=""))) Black cottonwood genome | | organism: Populus trichocarpa (Black cottonwood) | provider: Phytozome (JGI) | provider version: 3.0 | release date: January 2010...Ptrichocarpa" get(ls("package:BSgenome.Ptrichocarpa.Phytozome.v3")) Black cottonwood genome | | organism: Populus trichocarpa (Black cottonwood) | provider: Phytozome (JGI) | provider version: 3.…

Alignment BSgenome safe BSgenome MEDIPS Alignment BSgenome safe BSgenome MEDIPS

updated 12.0 years ago • Vining, Kelly

all these aspects and allow different steps to load data, > corresponding to the level of data organization, GSM to GPL, converting them > in ExpressionSet type. > Hi, Alex. Your understanding is correct. GSE and GDS contain

Sequencing Microarray Genetics Annotation gpls convert GEOquery GEOmetadb Sequencing gpls

updated 15.4 years ago • Sean Davis

cell biology to bring novel treatments straight to patients to prevent disability, repair failing organs and to treat degenerative diseases. We currently have a number of exciting programmes, including efforts focussing

Transcription Sequencing Microarray Normalization Pathways PROcess Transcription Sequencing

updated 16.3 years ago • Alexandre Kuhn