Bioconductor Forum

illu mi naRatBCv1"),setType=KEGGCollection()) > illumina.rat.kegg GeneSetCollection names: 04110, 00400, ..., 00640 (184 total) unique identifiers: 2260270, 5900358, ..., 580441 (2557 total) types in collection: geneIdType...idType=AnnotationIdentifier("illumi na RatBCv1"),setType=GOCollection()) Error in as.vector(x, "character") : cannot coerce type 'S4' to vector of type 'ch…

Annotation GO Annotation GO

updated 17.6 years ago • Johnstone, Alice

aln <- readGAlignments(bv) Error in readGAlignments(bv) : Assertion on 'more.args' failed: Vector must be named > sessionInfo() R Under development (unstable) (2015-07-07 r68639) Platform: x86_64-unknown-linux-gnu (64-bit

genomicalignments rsamtools

updated 10.5 years ago • Arne Muller

I'm new to using ALDEx2, so have a very simple question about how to create the aldex.clr object described here https://www.bioconductor.org/packages/devel/bioc/manuals/ALDEx2/man/ALDEx2.pdf using a data frame. The documentation provides this example: ``` # The 'reads' data.frame or # RangedSummarizedExperiment object should # have row and column names that are unique, …

ALDEx2

updated 3.5 years ago • Greg

spots because the SMD doesn't include that information in their raw data files. The input is just a character vector of file names. The files should have all used the same chip layout. -Colin On Feb 24, 2004, at 7:59, Aedin wrote: &gt

marray marray

updated 21.9 years ago • Colin A. Smith

Hallo! I am currently writing my masters thesis and am trying to create an org.*XX*.eg.db object for *Pon abelii*, for a GO analysis with the R-package clusterProfiler, and this requires this kind of object. For orangutan this does not exists as an already available R-package. I created a TxDB object and wanted to use the command "makeOrganismDbFromTxDb(txdb_Orang, keytype="GENEID", orgdb=NA)…

annotation

updated 5.4 years ago • amafon95

I'd like to manually add a vector of transcript sizes to my DDS object.  I tried setting: <pre> dds@assays$data$avgTxLength=data.frame(row.names=txOrder...avgTxLength"=tlen[txOrder,])</pre> Where txOrder is the row names from the dds data and tlen is the (out of order) transcript list for those row names.  The error I get when I try using fpkm...is "invalid 'dimna…

deseq2 fpkm

updated 8.4 years ago • rhart

<div class="preformatted">Robert Castelo <robert.castelo ...="" at=""> writes: <snip> > the newline character '\n' i was giving to the separator 'sep' parameter > in the paste function should be written as '\\\n'. doing it this way my &gt...class="preformatted">Robert Castelo <robert.castelo ...="" at=""> writes: <snip> > the newline cha…

updated 17.5 years ago • Brian D.Peyser,Ph.D.

in Limma 2.4.4 (complete sessionInfo at the end). In the vignette on pg. 12, it says you can put a "Name" column in your Targets.txt file to give a shorter label for output, graphs, etc. However, when I did this and called readTargets...the rownames of the targets object were the longer file names. Looking at the code for readTargets, it appears the column has to be called "Label", not "Name"? I…

limma limma

updated 20.1 years ago • Jenny Drnevich

select distinct core_mps.transcript_cluster_id, type from featureSet inner join core_mps", : EXPR must be a length 1 vector ``` Could you shed light into this problem? Thanks in advance

annotation affy

updated 6.7 years ago • a.karanikolou

a variable that can be passed to justRMA (see ?justRMA for the help file). If you want the column names to be the cel file names, just do Data1 <- justRMA ( phenoData=pD1) exprs2excel(Data1,"spreadsheetname.xls") You will have...to hand enter 'Gene Names' in the first cell of the spreadsheet. You could probably hack the code for read.table() to get it to put 'Gene Names' in the...T, sep=…

Microarray Genetics Cancer Microarray Genetics Cancer

updated 21.8 years ago • James W. MacDonald

export the matchprobes result to a table. I checked the documentation, saying the result is list of vector. Is there a specicial funtion to do it or I need to loop through the list and write the content to a text file? Thanks a lot

probe matchprobes probe matchprobes

updated 20.2 years ago • Lingsheng Dong

div class="preformatted">Hi, When I do Data<-ReadAffy(widget=TRUE), the sample names appeared to be what I want, i.e. 10E, 2D, etc.  But, after the data are read, when I type sampleNames(Data), the sample names...is the whole path of the file, like c:\my documents\....\....CEL, the names are simply too long for histogram.  Anybody know how to fix the sample names? Th…

updated 21.9 years ago • Yen Lin Chia

Dear Gabe, thanks a lot for making the `` genbankr `` package available. Today, I tried to parse a genbank entry for a synthetic DNA molecule, e.g. [KR709867.1](https://www.ncbi.nlm.nih.gov/nuccore/KR709867.1). Importing this file by accession failed: <pre> id = GBAccession("KR709867.1") readGenBank(id) Error in .normargIsCircular(isCircular, seqnames) : length of suppl…

genbankr

updated 9.1 years ago • Thomas Sandmann

the use of `XStrings` object, as it can accomodate only standard IUPAC nomenclature, and use the character vector as the string input with suitable downstream checks. Is this strategy adequate or is there any alternative

BioStrings Inosine bases Hydroxyadenine Azobenzene IUPAC

updated 7.0 years ago • aravind-j

1] "Biostrings" > head(genome.fa) A DNAStringSet instance of length 6 width seq names [1] 78885850 AAGCCCTAAAAGAAAATAACTTGCAACCTAGACTGTTATATCCAGCAAAATTATCTTTCAAAATTGATGGGAAAATTAGATACT…

BSgenome getSeq

updated 8.4 years ago • rubi

with 33538 rows and 3 columns ID Symbol Type <character> <character> <character> ENSG00000243485 ENSG00000243485 MIR1302-2HG Gene Expression ENSG00000237613 ENSG00000237613...with 33538 rows and 3 columns ID Symbol Type &…

SingleCellExperiment

updated 6.7 years ago • Matthew Thornton

T, sep="\t') note: phenodata.txt is a text file with variables in columns and samples number and/or names in rows. The output file appears to have the correct number of cases (133) and variables (20) Then I create a file, x, that has...all the CEL file names. Then I attempt to create a Affybatch using justRMA: Data1 <- justRMA (sampleNames=x, phenoData=pD1) The output file, a matrix.…

Genetics Genetics

updated 21.8 years ago • Joshi, Nina NIH/NCI

DEXSeq Bioconductor package when creating the object "DEXSeqDataSetFromHTSeq". I have changed a few names (files and paths) for confidentiality and clarity purposes! Error: Error in strsplit(rownames(dcounts), ":") : non-character...condition:exon,flattenedfile=flattenedFile ) Error in strsplit(rownames(dcounts), ":") : non-character argument > sessionInfo() R version 3.2.1 …

dexseq rnaseq differential exon usage

updated 10.4 years ago • arom2

or median tss.avg <- viewMeans(tss.cov) tss.med <- viewApply(tss.cov, median) tss.cov has names for each gene feature: > class(tss.cov) [1] "SimpleRleViewsList" attr(,"package") [1] "IRanges" > tss.cov[[1]][1:3] Views on a 230218...20.3 20.1 20.0 19.8 19.1 ...etc. [3] 166167 166366 200 [14.9 14.9 15.1 15.1 15.1 15.1 ...etc. > names(tss.cov[[1]])[1:3] […

Coverage convert Coverage convert

updated 11.7 years ago • Chris Seidel

div class="preformatted">Hi I was trying to make a data.frame of geneIDs, symbols and names for my eset, but the cdf and .db did not match up. > library(mogene10sttranscriptcluster.db) > library(mogene10stv1cdf...number of rows: 34760, 35556, 1 > summary(geneIDs) Length Class Mode 34760 character character > summary(geneNames) Length Class …

cdf cdf

updated 11.5 years ago • Joel Ma

cn\[, 6\], chrom = cn\[, 1\], maploc = cn\[, 2\], data.type = "logratio") :   genomdat must be numeric But the data in the coloum 6 of "output.copynumber" are all decimal numbers, so I am confused why I got this

DNAcopy Varscan

updated 5.1 years ago • jinxinhao1988

the error message: Error in as.list.default(X) : no method for coercing this S4 class to a vector How can I fix this? Thanks in advance, JS

annotation genomation

updated 7.0 years ago • janani.sundaresan

Outputs: <pre> DataFrame with 3 rows and 2 columns a b <numeric> <character> 1 1 a 2 2 b 3 3 c</pre> Now add a list of data frames as new column of DataFrame. These data frames may have different columns...df</pre> Outputs an error: <pre> DataFrame with 3 rows…

s4vectors dataframe

updated 8.9 years ago • Welliton de Souza

work> >Date: Mon, 20 Mar 2006 13:22:54 -0500 > >boxplot(MAset$M[,j]~MAset$genes$Block,names=c("A","B","C")) > >will replace the default names by "A", "B" and "C". > >?boxplot > >gives the list of parameters that can be changed...labels ? The default is obviously the Block number, and I >>would like to replace it with …

limma limma

updated 19.8 years ago • Naomi Altman

lt;- matrix(charToRaw(as.character(unlist(qual))), nrow=length(qual), byrow=TRUE) Error in .Call(.NAME, ..., PACKAGE = PACKAGE) : negative length vectors are not allowed as(qual, matrix) gives the same error, and as.matrix(qual) does

charm charm

updated 12.6 years ago • Sam McInturf

but not required) to use ## only letters, numbers, and delimiters '_' or '.', as these are safe characters ## for column names in R. [This is a message, not a warning or an error] dds # n = 55,401 ## class: DESeqDataSet ## dim: 55401 13 ## metadata...ENSMUSG00000028180 ENSMUSG00000028182 ... ## ENSMUSG00000036959 ENSMUSG00000042678 ## rowData names(0): ## colnames(13): Control_1 Control_2…

DESeq2

updated 3.8 years ago • Manav

kb="" lack="" me="" memory,="" of="" size="" someone="" sufficient="" tell="" thanks="" this="" to="" vector=""></error:></div

updated 20.5 years ago • Christina Curtis

with SYMBOL... Error: 2 errors; first error: Error in array(x, c(length(x), 1L), if (!is.null(names(x))) list(names(x), : 'data' must be of a vector type, was 'NULL' For more information, use bplasterror(). To resume calculation, re-call

Annotation Preprocessing hgu133plus2 hgug4112a

updated 11.3 years ago • Guest User

attr(,"package") [1] "IRanges" ``` For the transcript dataset, it is a vector ``` > phenoTable <- colData(rse_tx) ## phenotype per run > class(phenoTable$characteristics) [1] "character" ``` Is there a way

software error recount

updated 6.0 years ago • Jacques.van-Helden

value. The .fcs standard mentions that If the delimiter appears in a keyword or keyword value, it must be immediately followed by a second delimiter. I see that the error message that emptyValue generates states that you

software error

updated 5.2 years ago • andrea.mcewan

parsing failures. row col expected actual 1122 NumReads no trailing characters .56607 1123 NumReads no trailing characters .43393 1125 NumReads no trailing characters .325 1132 NumReads no...trailing characters .989 1133 NumReads no trailing characters .385 .... ........ ...................... ...... See problems(...) for more details. 2 Parsed with column specificat…

tximport readr read_tsv

updated 9.3 years ago • Jenny Drnevich

<div class="preformatted">I'm trying to get text descriptions of PFAM family names from the PFAM package. I've tried to run the example code from the pfamAC2PDB help. > AC2DE <- pfamAC2DE() > head(AC2DE) $PF00244 [1] "14-3-3 protein" > pfamAC2DE(ac=sample(names(AC2DE), 3)) Error in sample(names(AC2DE), 3) : cannot take a sample larger than the population…

updated 17.9 years ago • Daniel Gatti

Hi, I'm running the enrichPathway function: x<-enrichPathway(gene=df$name, organism = "fly", pvalueCutoff = 0.05, pAdjustMethod = "BH", qvalueCutoff = 0.2, universe, minGSSize = 10, maxGSSize = 500, readable...Hi, I'm running the enrichPathway function: x<-enrichPathway(gene=df$name, organism = "fly", pvalueCutoff = 0.05, pAdjustMethod = "BH", qvalueCutoff = 0.2, unive…

enrichPathway ReactomePA

updated 5.7 years ago • DataFanatic

some ChIP seq data using DESeq, reads have all been aligned and are in BAM format. "aligned" in a names character vector containing the names of the bam files. I'm trying to use the Genominator function importFromAlignedReads

Genominator DESeq Genominator DESeq

updated 13.7 years ago • Boel Brynedal

preformatted">Dear all, Is there a way with Bioconductor in which I can convert such EnSemBL probe names into the standard gene names? AFFX-M27830_5_at AFFX-M27830_M_at ENSG00000000003_at ENSG00000000005_at ENSG00000000419_at

probe probe

updated 17.3 years ago • Gundala Viswanath

<div class="preformatted">Hello, My name is Germain and I'm Bioinformatician. I have installed R (v 2.4) on RHEL5, and I try to read 93 CEL files with ReadAffy function. Despite 8Go RAM, I obtain this error : Error: cannot allocate vector of size 762 Mo ... I read all topics about this error and try all proposed solutions, but it still doesn't work. By unix "top" command...div class="…

affy affyio trigger affy affyio trigger

updated 17.6 years ago • Germain Paimparay

example.bed", format="bed") # and obtained the error: Error: $ operator is invalid for atomic vectors Thanks in advance! ------------------------------------------------------------------------------------------------------------------------- R version 4.0.2 (2020-06-22) Platform: x86_64-w64-mingw32/x64 (64-bit) Running under: Windows 10 x64 (build

import

updated 4.5 years ago • Ofelia

nbsp;   Warning messages:     1: In is.na(go) : is.na() applied to non-(list or vector) of type 'NULL'     2: In is.na(go) : is.na() applied to non-(list or vector) of type 'NULL'     3: In is.na(go) : is.na() applied...to non-(list or vector) of type 'NULL'     The contents of the list are: __> pr…

GOSemSim mgeneSim

updated 9.7 years ago • ረ

I have gone through the vignette and parts of the reference manual but I am still stuck. I have a vector of gene symbols, call this vector “Vec”. These are all the genes which expression levels I have measured with RNA-Seq. Subsequently...em>  unable to find an inherited method for function ‘GeneSetCollection’ for signature ‘"character", "SymbolIdentifier", "GOCollection"’&l…

gseabase geneset

updated 9.0 years ago • siajunren

div class="preformatted">Dear Bernd and List Members: I'm getting a segmentation fault reading in a character vector (attached) written by rhdf5. If anyone can make a suggestion how to get rhdf5 to read this without throwing...file appears to be written correctly since h5dump can read it. I got the same error with the same vector on both my mac laptop and our linux server, in both cases usin…

rhdf5 rhdf5

updated 11.0 years ago • Brad Friedman

<div class="preformatted">Hi everybody, I need to convert my mouse affymetrix ID into their correspondent human orthologues ID (more precisely I have to go from mouse430a2 to HG133_Plus2). I found this package inBioC: AnnotationTools. First of all, I am trying to recover the orthologues annotations from mouse to human array by following the commands from the tutorial, but I have an err…

GO mouse430a2 probe convert annotationTools GO mouse430a2 probe convert annotationTools

updated 16.5 years ago • Giusy Della Gatta

<div class="preformatted">Hello - Sorry if this message appear twice, before I sent from the wrong e-mail address(not registered) I trying to make a function in R but I couldnt figure out whats happening. I loadded a fasta file. seq2 <- readDNAStringSet("c:/teste/testfile.txt","fasta") I would like to get the length. If I execute dir…

updated 12.8 years ago • Thiago Maia

A - B. But the lengths of the coverages aren't going to be exactly the same, which means that the vectors will be rotated. This is not what I want. For example, if the Rle in chr1 in A is longer than that in B I want to extend chr1...print("computing coverage") chip = coverage(chip) background = coverage(input) for (n in names(chip)){ sumc = sum(runLength(chip[n])) sumb = sum(runL…

iranges s4vectors rle rlelist

updated 7.5 years ago • endrebak85

code below). I was wondering if anyone has an idea about how to change the default affy-IDs as row names in a KEGG2heatmap (or GO2heatmap) to have gene symbols or gene names for that matter displayed in the heatmap. Changing...c(9,9), col=bluered(256),ColSideColors=groups.color2,cexRow=1.2) ##gives what I expect, with row names written as probeset Affymetrix Ids > matrix_eset_1108_symb…

Annotation GO annotate affy Annotation GO annotate affy

updated 17.5 years ago • Celine Carret

preformatted">Dear Buddy, Happy Christmas. I am a user of R. When I attempt to correlate a vector x with a matrix y, R warn me of incompatible dimensions (unequal numbers of rows) . Should I use lapply? I need the average

updated 13.0 years ago • 刘伟

Is there an easy way to swap the row names in this data frame (in this case ensembl gene ids that were the first column in the gene count table generated from STAR...Is there an easy way to swap the row names in this data frame (in this case ensembl gene ids that were the first column in the gene count table generated from STAR) with gene id? I would like to keep all the identifiers in the tab…

deseq2 dataframe ensembl gene id gene symbol entrezid

updated 6.0 years ago • jason.williams

Connection resource requested as a path</pre> Pass nothing to the `` con `` argument to retrieve a character vector that will then be written using `` gzfile ``: <pre> > test = export(object=BSgenome.Vvinifera.URGI.IGGP12Xv2

bsgenome gzip fasta

updated 9.7 years ago • TimothéeFlutre

Hi all, I am currently trying to convert the Illumina Human Methylation 450k annotation from the provided RefSeq IDs to ensembl gene IDs (if anybody has done this before and could give the the files that would be perfect!). So when I use biomaRt to get the ensembl IDs of the ~20000 mRNA RefSeq IDs I always get the error: Error in getBM(attributes = c("refseq_mrna", "ensemb…

biomart

updated 6.6 years ago • laurenz.holcik

integer(0), elementMetadata = NULL, metadata = list()), seqinfo = new("Seqinfo", seqnames = character(0), seqlengths = integer(0), is_circular = logical(0), genome = character(0)), elementMetadata = new("DFrame", rownames = NULL, nrows...elementType = "ANY", elementMetadata = NULL, metadata = list(), listData = structure(list(), names = character(0))), el…

DESeq2 DifferentialExpression

updated 18 months ago • nhaus

Zhu, Julie <julie.zhu@umassmed.edu> wrote: Hi Eric, Please try the following code. You had the gene names in space which needs to contain chromosome names. peaks = RangedData(IRanges(start=SeqTest$start, end=SeqTest$end, names...character> <iranges> | peak1 NC_008253 [100, 300] | peak2 NC_010468 [500, 600] | > SeqTest = read.table(file="2Rp_50base.txt", header=TRUE...7…

Biostrings ChIPpeakAnno Biostrings ChIPpeakAnno

updated 15.8 years ago • Julie Zhu

chromosome\_name", "start\_position", "end\_position", "external\_gene\_name", "go\_id", "name\_1006"), silence=TRUE)_ __Error: There is no feature column in annotatedPeak or               annotatedPeak...In addition: Warning message: In is.na(feature\_ids) :   is.na() applied to non-(list or vector) of ty…

software error annotation

updated 9.1 years ago • jmKeith

for any suggestions. > peaks = RangedData(IRanges(start = c(100, 500), end = c(300, + 600), names = c("peak1", "peak2")), space = c("NC_008253", + "NC_010468")) > peaks RangedData with 2 rows and 0 value columns across 2 spaces space...character> <iranges> | peak1 NC_008253 [100, 300] | peak2 NC_010468 [500, 600] | > SeqTest = read.table(file="2Rp_50…

ChIPpeakAnno ChIPpeakAnno

updated 15.8 years ago • Julie Zhu

T>A 1140 T>C 8198 T>G 1830 My concern is, along with the position i want the gene names so is it possible to get the gene names from SigProfilerMatrixGenerator output ? and if not that whats the other way to...get the gene names from VCF files

BioCor StarBioTrek MatrixGenerics

updated 2.2 years ago • karmasstark

to construct the design matrix. Are there similar functions for "automatic" generation of the design vector when considering duplicate spots using "duplicateCorrelation" and "gls.series"? Looking forward hearing from you

updated 21.5 years ago • Jakob Hedegaard

Hi, I want to import data to R with the columns name of these: \#ID  study1cond1  study1cond1  study1con2  study1con2  study2con1  study2con1 &nbsp...nbsp; 0               84  But after importing the columns\` name change to: \#ID  study1cond1  st…

software error deseq metarnaseq HTSFilter columns

updated 8.5 years ago • ed_isfahani

preformatted">Hello I was reading the guidelines at the bioconductor developer page. But how about naming functions? There is a part for "variable names" and the hint for using namespaces. In several packages I found functions...of the kind: "just.rma" Is using the "dot" in a function name permitted and has the "dot" any meaning? Thanks Markus -- Dipl.-Tech. Math. Markus Schmidberger Ludwi…

updated 18.4 years ago • Markus Schmidberger

annotatedPeak as a RangedData returned from annotatePeakInBatch which contains a field feature, or a character vector containing the feature IDs. Supported feature ID types are ensembl_gene_id, refseq_id, gene_symbol and...names.ensembl_gene_id names.RefSeqIds names.Entrez.ID <http: names.entrez.id=""> names.Gene.Symbol <character> <iranges> | <character> <…

GO ChIPpeakAnno GO ChIPpeakAnno

updated 14.5 years ago • Julie Zhu

Error in nsc(data$x[gene.subset, sample.subset], y = y, proby = proby, : Error: each class must have >1 sample There is discussion in the documents (http://www- stat.stanford.edu/~tibs/PAM/Rdist/doc/readme.html) about

GO pamr GO pamr

updated 21.4 years ago • Dick Beyer

Below is how we performed GO enrichment analysis, both the background and input genes are vector of characters containing entrez gene ID. <pre> ###set up backgrourd genes x<-org.Hs.egGO mapped_genes<-mappedkeys...set up input genes go_object<-sample_to_be_test ###Enrichment analysis: class(go_object)<-"character" universe<-mapped_genes params&am…

gostats

updated 11.2 years ago • ylc35

GRanges object with 3 ranges and 2 metadata columns: seqnames ranges strand | name score <Rle> <IRanges> <Rle> | <character> <numeric> [1] chr1 [ 4, 6] + | TF1 0 [2] chr1 [ 9, 9] + | TF1 0 …

r granges genomicranges

updated 7.3 years ago • g.k