Hi there, thank you for taking the time to consider my threat. I have a character object consist of short reads of DNA sequences which looks like this:
> rnd1
[1] "ATCCTTCTGCGGAACCAAATAT" "TTTGTTTGTTCACGATAACACC
Order by: Relevance
GOCollection())
setwd("/path/")
save(Sc.gsc, file = "Sc.gsc.Rda")</pre>
Now, if I'm not wrong I must select the universe of genes present at my experiment. I have a list of characters with the genes that are present in my...pre>
universe = Lkeys(org.Sc.sgdGO)
genes = universe[1:500]
params <- GSEAGOHyperGParams(name="My Custom GSEA based annot Params",
+ geneSetCollection=S…
updated 10.9 years ago • nonCodingGene
I have been working with a RNAseq dataset and wanted to change the names of my GENEID during tximport so I could match it with a dataframe in a downstream analysis. However, if I change the GENEID...for both gene and transcript
tx2gene$TXNAME = as.character(tx2gene$TXNAME) #make sure it's a character vector
TXNAME = as.vector(tx2gene$TXNAME)
GENEID = as.vector(tx2gene$GENEID)
…
assays = SimpleList(counts = countData), :
the rownames and colnames of the supplied assay(s) must be NULL or
identical to those of the SummarizedExperiment object (or derivative)
to construct
```
It will be great to get...DESeq2.
I run the DESeq2 in my old machine and it runs without issues which means that the column names in the counts are same as the row names of the coldata…
updated 3.0 years ago • Cherif
How do the three `Vector -> data.frame` coercers in `S4Vectors`relate to each other?
setAs("Vector", "data.frame", function(from) as.data.frame(from...as.data.frame(x, row.names=NULL, optional=optional, ...)
}
setMethod("as.data.frame",
"Vector",
function(x, row.names=NULL, optional=FALSE, ...){
x <- as.vector(x)
…
The following biomaRt query returns the minor\_allele column as logical instead of character:
<pre>
library("biomaRt")
mart <- useMart(host="feb2014.archive.ensembl.org", biomart="ENSEMBL_MART_SNP")
ensembl...C 0.000459137
6 T 0.000459137
> class(res$minor_allele)
[1] "character"
</pre>
Is there any way to circumvent th…
it always gives me the error message of
Error in rename(df, c(X_id = "_id")) :
Some 'from' names in value not found on 'x': X_id
If my input is a symbol, it works perfectly fine. For example, I have two rat genes Abcc3 and Havcr1...Finished
DataFrame with 2 rows and 4 columns
query _id X_score entrezgene
<character> <character> <numeric> <c…
I am getting confused with regard to a particular thing. At one place, it suggests that a correction vector is identified for a cell in the target batch which is an averaged correction vector from all MNN pairs of that cell with...The MNN pairs help identify local variation in subpopulation of the target batch. But then the batch vector, the component of correction vector that is actually removed…
updated 4.3 years ago • p.joshi
mget(abaupr, ath1121501ACCNUM)
#Error in .checkKeys(value, Lkeys(x), x at ifnotfound) :
# the keys must be character strings
#I looked up ifnotfound in mget.....and still dont understand #the
error.
#the only option is NA, but.........
a1=mget...ath1121501ACCNUM,ifnotfound=NA)
#Error in .checkKeys(value, Lkeys(x), x at ifnotfound) :
# the keys must be character strings
My lack of understandin…
why I'm not getting any results back from BiomaRt (0 rows)? Is it because my filter object isn't a character vector? If that's it, how can I export my DSNorm first column (my ensembl ID's) as a character vector in the filter object...for my Genes.
DSNorm <- read.csv("TKvIL_DESeq2_Counts.csv", header=TRUE)
#assign Col1 for row names
rownames(DSNorm) <- DSNorm$ensembID
filter&am…
cpm(y) of edgeR. I get the following error:
<code>Error in .isAllZero(counts) :<br/>
long vectors not supported yet: memory.c:3438<br/>
Calls: mergeTables -> DGEList -> .isAllZero -> .Call</code>
This is obviously a memory...issue and was just wondering if long vectors will be supported in the near future. I usually have no problems with…
on a larger bamfile, I receive the following error:
**Error in .local(x, ...) : strand values must be in '+' '-' '*'
Calls: splitGAlignmentsByCut ... normalize_strand_replacement_value -> strand -> strand -> .local**
I checked the
small data sets, but could be an issue for larger data sets, like mine. Whether I give seqlengths a vector with one integer per row of data, or only the unique interger values for each scaffold length I get an error (see code...c18977.IR <- IRanges(start = c18977$sub_start, width = abs(c18977$sub_start - c18977$sub_end), names = seq(1:length(c18977$sub_start)))</pre>
4) create the G…
updated 11.3 years ago • topher.hamm
probeset ids from another program and
would
like to use annaffy to extract the corresponding gene names. I am
still
something of a novice at R and am probably doing something silly, but
found no answer in the package vignette...by
this
script. WHat am I doing wrong?
THanks Peter
s<-as.character(symbols)
> s
[1] "character(0)" "character(0)" "character(0)"
[4] "char…
Hi everyone!
Whilst exploring the functions in `` Rsamtools `` and getting familiar with it, I seem to have stumbled upon a potential Bug.
I was trying to using the `` ScanBam() `` function to extract part of my bam file while selecting for a optional tag named "B1".
For example, given these example lines from the bam file :
<pre>
NS500688:47:HG2VTBGXX:1:22304:7555:…
command. The above example uses the integrated demoList1 example dataset which contains geneids as a character vector.</span>
<span style="line-height:1.6">I have uploaded a simple csv file containing a list of 2000 gene IDs (corresponding...data set ‘genelistdavid’ not found</pre>
The same thing happens when I create a new character vector from genelistdavid using as.characte…
updated 10.9 years ago • hpw9
in the KEGGsoap package:
I'm new to the package, but as I understand it I should be able to
pass a vector of gene IDs and receive back a vector of pathway IDs,
however I keep getting a 'xmlns: URI SOAP/KEGG is not absolute' error...genes)
> xmlns: URI SOAP/KEGG is not absolute
> xmlns: URI SOAP/KEGG is not absolute
> character(0)
>>
>> KEGGserver …
<div class="preformatted">Dear All,
we would like to use the computeRawQ function, but the documentation
is very scarce:
Arguments
fname character string with the filename of the
GeneChip
intensity &a…
updated 15.8 years ago • Dr Gyorffy Balazs
following error:
```r
Warning messages:
1: Computation failed in stat_signif():
'x' and 'g' must have the same length
2: Computation failed in stat_signif():
'x' and 'g' must have the same length
```
We would greatly appreciate
updated 2.9 years ago • Elif
Is this a bug in renameSeqlevels or expected behaviour? Note the weird
ordering of chromosome names in txbygene (chrX between chr7 and chr8)
which then results in misnaming when I try to use renameSeqlevels
(everything...after chr7 is off by one). The docs for renameSeqlevels
aren't explicit in whether the renaming vector has to match the
ordering
of the original names, but I thought the point of…
updated 13.7 years ago • Alex Gutteridge
argument 'which' in selecting a method for function 'ScanBamParam': Error in asMethod(object) : The character vector to convert to a GRanges object must contain strings of the form "chr1:2501-2800" or "chr1:2501-2800:+" (".." being also
updated 10.0 years ago • K
<div class="preformatted">Hi I am a novice in both R and EdgeR. I have a readcounts tab
seperated file (with around 24 conditions belonging to 6 different
groups with its first column containing the tag identifiers and the
other columns containing the read counts. I used read.delim function
in R in the following manner :-
seq_data <- read.table("newfile.txt", header = TRUE, sep = "…
<div class="preformatted">Hi Karl, Seth,
This problem is probably caused by the SJava version you are using.
There
has been an update recently of SJava to SJava 0.68. Appearantly some
functions of SJava return a different data type, which causes errors
in
RMAGEML. I only spotted this very recently and haven't had time to
update
RMAGEML. I'll do this as soon as possible. For now, you sho…
fitting on my data but i keep getting the
following error
Error in rowMeans(y$exprs, na.rm=TRUE):'x' must be numeric
But I'm not sure what the problem is does anyone have suggestions?
Here's what i've been doing after normalization...data, dim 39693 240
fit <- lmFit(expr,design)
Error in rowMeans(y$exprs, na.rm=TRUE):'x' must be numeric
Thanks,
.kripa
[[alternative HTML version …
When I try to compare 3 different platforms, it gives error
message like this:
Error in as.vector(x, "character") :
cannot coerce type 'closure' to vector of type 'character'
Here are my questions:
Can matchprobes be used for more than
updated 16.1 years ago • qian kui
library("org.Hs.eg.db")
library("topGO")
all_genes <- rep(c(0,1,1), each=10)
names(all_genes) <- c("LEF1","FOXJ2","ZNF654","TAL1","ZMYM2","DCAF6","PDP1","ZNF302","TMED4","SLC5A6","PLSCR1","RPL41","MARK1","TMSB10","HES6","CACNA2D3...There are no adj nodes for node: GO:0120163 Error in switch(type, isa = 0, partof = 1, -1) : EXPR must be a length 1 vector
Same error o…
updated 7.1 years ago • natske
<div class="preformatted">
Dear all, Have been trying to use random forest for classification
and i keep getting the error cannot allocate vector size of 1.8 Gb. I
am working on R 64 bits under windows 64 bits. I had a 3gb ram and
then upgraded it to 8 to try to solve the problem...been trying to use random forest for classification
and i keep getting the error cannot allocate vector…
updated 13.8 years ago • Salwa Eid
<div class="preformatted">Hi all,
I need to analyze a combined dataset of microarrays from two sources.
The
arrays for the first cell type is from source1 and the arrays for the
other
cell types are from source2. I would like to use the advanced rank
product
method to identify the unregulated genes. My "origin" vector and
sample
vector are as following. However, by using the following code…
updated 14.2 years ago • Wendy Qiao
How can one store a `matrix` in a particular column?
```r
> DataFrame(name = "test", value = I(matrix(1:4, ncol = 2)))
DataFrame with 2 rows and 2 columns
name value
<character> <matrix>
1 test 1:3
2 test 2:4
```
I had hoped...of two rows and two columns in the first row and second column of the `DataFrame`.
</matrix>…
updated 10 months ago • Dario Strbenac
When I use colCustom argument, legendLabels argument does not work and use of expression function in named vector is not supported.
1. Do you know if there is a way to replace the names of keyvals by legend labels in order to be able...black',
'black'))
)
keyvals[is.na(keyvals)] <- 'grey'
names(keyvals)[keyvals == 'dodgerblue'] <- "p-value an…
updated 3.2 years ago • elefth.pavlos
using ggycto and autoplot but also to rearrange the frames in a specific order.
I first created a vector with the sample names and then created a matrix that will show the order of the frames in the plot.
I use a vector becuase...I truncate it to 49 for another reason unrelated to this question.
# Create a 96 well plate name spece in a vector
wholeplate <- vector()
row…
updated 5.6 years ago • alavy
<div class="preformatted">HI , Iam trying to use cghMCR to find common regions in 32 samples
(244K
mouse agilent array)
I have installed version 1.8.0
I have done this first step sucessfully
require("limma")
arrayFiles <- list.files(system.file("Data", package = "cghMCR"),
full.names = TRUE)
then when I try to use read.maimages (limma) to read the data I have
this
error messa…
Error in `*tmp*`$samples : $ operator is invalid for atomic vectors
```
> x <- as.matrix(read.delim("E:/bioinformatic/RNAseq/GSE168008_raw_count.txt", sep ="" ,row.names = 1))
> dgelist <-DGEList...gt; x$samples$group <- group
Error in `*tmp*`$samples : $ operator is invalid for atomic vectors
```
Many thanks for your help
updated 4.3 years ago • lq.ke
_' or '.', as these are safe characters
for column names in R. \[This is a message, not an warning or error\]
using 'avgTxLength' from assays(dds), correcting...estimates
mean-dispersion relationship
Note: levels of factors in the design contain characters other than
letters, numbers, '\_' and '.'. It is recommended (but not required) to use
&…
lt;- lmFit(y0, design)</pre>
It shows that
<pre>
Error in array(x, c(length(x), 1L), if (!is.null(names(x))) list(names(x), :
'data' must be of a vector type, was 'NULL'</pre>
This problem is similar with the one posted at https://support.bioconductor.org...been solved yet.
<pre>
> traceback()
5: array(x, c(length(x), 1L), if (!is.n…
updated 9.5 years ago • Jesse L.
Both columns of the vj data.frame are Factors, so asking to replace NAs or empty positions by a character string is a wrong code, since the level "unresolved" doesn't exist.
vj[is.na(vj) | vj == ""] <- "unresolved"
So the piece...of code above must be introduced after the conversion of the vj columns to Character, not before.
(II)
When the asso…
updated 8.7 years ago • omran.allatif
p>
<pre>
Error in data.frame(row.names = colnames(countdata), condition) :
row names supplied are of the wrong length</pre>
<p>Then, I tried running it without condition, which works. However, when I try to run...code>Error in DESeqDataSet(se, design = design, ignoreRank) :
all variables in design formula must be columns in colData</code><…
div class="preformatted">Hi:
In sigPathways package, if I have characters for defining a pheno
object, how is sigPathway treating the class labels based on pheno
object.
for example:
my.pheno...considers to computer t-statistic. Normal/cancer or cancer/normal.
similarly, if I define binary vector for pheno class lable, is 1/0
considered or 0/1 considered.
thank you.
Ad
</div
updated 16.5 years ago • Adrian Johnson
con, subformat, append, ...) :
Track not compatible with WIG/bedGraph: Overlapping features must
be
on separate strands and every feature width must be positive
> B18mtrack
RangedData with 33608 rows and 2 value columns...across 1 space
space ranges | chr score
<character> <iranges> | <character> <numeric>
1 …
updated 14.8 years ago • Lavinia Gordon
1 elementMetadata value
# seqnames ranges strand | geneNames
# <rle> <iranges> <rle> | <character>
# [1] chrB [1, 20] * | g1
# [2] chrC [1, 20] * | g2
# [3] chrB [5, 10] * | g3
#
# seqlengths
# chrB chrC
# NA NA
## can't use GRanges directly
Views( myRleList, myRegions...Error in RleViewsLis…
updated 14.4 years ago • Janet Young
lt;- gr$type <- gr$gene_version <- NULL
```
Index the ranges by their order.
```r
names(gr) <- 1:length(gr)
```
Extract their 5-prime ends, copy the index, then sort.
```r
p <- GPos(promoters(gr, 0, 1))
names(p) <- names(gr)
p <- sort...hh <- p[plusMinus]
```
Use the indexes to retrieve the original ranges.
```r
i1 <…
updated 5.6 years ago • Charles Plessy
ranges = IRanges(c(1,5,15,22,5,15,22),c(11,8,20,30,8,17,25)),
strand = Rle(strand(c("-", rep("+",6)))),
name = c('a', 'b','b','b','c','c','c')
)
> grSubject
GRanges with 7 ranges and 1 elementMetadata value:
seqnames ranges strand | name
<rle> <iranges> <rle...character>
[1] chr1 [ 1, 11] - | a
[2] chr1 [ 5, 8] +…
updated 14.0 years ago • Fahim Md
In the presence of NA's, then probeSetSummary2(hgOver) gives me this
warning
Warning message:
The vector of geneIds used to create the GOHyperGParamsobject was not
a
named vector.
If you want to know the probesets that contributed...to this result
either use a named vector for gene Ids, or pass a vector of probeset
IDs
via sigProbesets.
And then most GO terms go missing in the result.
What
and then tried to use the random forest classifier but i keep
getting the error "cannot allocate vector of 1.8G". I had a 3gb ram
and upgraded it to 8gb and am still getting the same error exactly.
In the first case got a warning
updated 13.8 years ago • Salwa Eid
Hi,
I would like to count the number of disjoint matches for a given pattern and character vector where matches are sought. So, basically what gregexpr is doing. However I would like to do this for a set of patterns...as well as a set of characters (such as XStringSet).
Right now I just apply gregexpr multiple times. Is there a more clever way to do this? I know about
updated 9.9 years ago • Stefanie Tauber
unique regions...
Number of unique short reads: 17855868
Calculating genomic coordinates...Error in vector(length =
supersize_chr[length(chromosomes)], mode = "character") :
vector size cannot be NA/NaN
Thanks for help,
Kelly V.</div
Hi All,
I am interested in using the ChIPseqR package for the MNASE data. I am new to using R, and I quite don't understand the error i am receiving.
My input is paired end BAM file, and I executed the following as per the reference manual.
aln1<- readAligned(path,pattern,type="BAM")
<code>sp <- strandPileup(aln1,chrLen=chr,extend=1,p…
updated 11.1 years ago • RT
Building most specific GOs .....
Error in as.character(x) :
cannot coerce type 'closure' to vector of type 'character'*
How can I solve that?
I don’t have this error when I use annFUN.gene2GO as annotation
gt; with heatmap.2 in the past that precluded the row ordering from
> working correctly (i.e., vector order if dendrogram was not used).
I
> haven't checked recently to see if that is still the case.
>
> Hope that helps.
>...results and I would like to
>> generate a heatmap with each gene plotted in the order of a vector
>> (specifical…
updated 16.4 years ago • Yannick Wurm
fails with a subscript error as markerInd is a list. On object inspection I find cod to be a string vector and markerInd to be a list with marker names holding single item vectors of numerics. Through step code debugging I...grep function finds more than one index for certain channels and thus returns a list instead of a vector. This turns out to be because of greedy behavior of the grep function…
updated 10.1 years ago • lovetatting
but I can't find a way to correct it.
This error is: Error in order(order) : argument 1 is not a vector
It seems to me that this is a format error, yet I followed the tutorial well
Do you have any ideas to help me?
Thank you
updated 6.5 years ago • yohann.clement
cannot do it. I cannot seem to make the instructions
at att.com for Graphviz work (using code of the characters). I have
tried to get a Unix version going through Aquamacs and have GD libgd
problems.
I have searched the web for
naive" way is taking a lot of time
and memory, but adding some extra code to change my target to a
character vector (from a DNAStringSet) with some careful subsetting
and reverseComplement-ing is much faster.
So I'm wondering...been over a few minutes on my machine, so I'm killing it.
Now let's do it another way, using normal character vectors and stuff
R> strings <- DNAStringSet…
<div class="preformatted">this is what you have to do.
in the exprs (intensity) slot of an AffyBatch put a matrix with as
many
columns as arrays and as many row as number of probes on the array.
in each column put the vector of intensities of each array. a row must
represent a unique location on the array. no you need to create a hash
table enviromnet with varialbles with names of the prob…
updated 22.9 years ago • Rafael A. Irizarry
olaps)))
splitAsList(mcols(query)[[column]][queryHits(olaps)], f1)
}
creates a character list for the gene symbol. For a variety of reasons I actually need each gene to be in a new line as seen below.
seqnames...SYMBOL
<Rle> <IRanges> <Rle> | <integer> <Character&…
updated 7.8 years ago • stephen.williams
in the list).
Now, I need to sum up two vectors (a.k.a, sum of vector indicates overall overlapped regions number for each). However, I did keep only one (the one with...NAs ``index now ( `` NAs ``values indicates non-overlapped regions).
I did sum over two vector, but R consider length of regions with `` NAs ``index as `` 1 ``, while R also consider length of region with `…
<div class="preformatted">Hi all,
Not sure if this is an appropriate question to ask of this group,
but figured better to give it a shot here than at R-help...
I'm trying to write DNA sequences to a file in fasta format. the
seqinr library has a function called write.fasta, which works fine,
except for one crucial point:
there's supposed to be a maximum number of characters per line (…
updated 15.9 years ago • Jonathan
a CNA object from a oligoSnpSet matrix after applying the crlmm package
I keep getting "genomdat must be numeric" error from my
oligoset<- OligoSetList(cnSet3, batch.name=batch(cnSet3)\[1\])
oligo<-oligoset\[\[1\]\]
CNA.object
updated 10.5 years ago • perdomos
BioC\_version\_associated\_with\_R\_version) :
cannot coerce type 'closure' to vector of type 'character' every time I try to update my packages.
 
updated 10.5 years ago • dnaseq
<div class="preformatted">Hi,
I'm a PhD student from the University of Ghent, and I'm just starting
to learn how to work with R.
The initial aim is to analyse qPCR data with the package HTqPCR so I
read quite a few manuals regarding the program R and HTqPCR.
My problem is situated right at the beginning of the analysis, namely
loading my data.
I think I got it correctly that I first have t…
Recent ...
Replies
Comment: Empty boxes in treemap plot rrvgo package
by
TikTsokaasocissalpc
•
0
Clear visualization matters just as much in mobile entertainment as in data analysis. The [Try KK33 Game App now][1] focuses on clean layou…
Comment: nice 3D displays for PCA analysis
by
adam80haynes
•
0
That's a fascinating application of 3D printing in a scientific context. Using this technology to create custom lab equipment, models of mo…
Comment: Bioinformatician at the Lausanne University Hospital
by
TikTsokaasocissalpc
•
0
The Random Word Generator in Italian is a useful tool for generating ideas and exploring new approaches, much like the innovative research …
Comment: DECIPHER DesignProbes unable to design FISH-probes
by
TikTsokaasocissalpc
•
0
If you want to share your research progress and microbiome discoveries with colleagues or friends, [snaptroid android][1] download free mak…
Answer: Limma-voom sample weights and impact on DEG numbers
by
Gordon Smyth
53k
I recommend that you always use voomLmFit() instead of the earlier voom() or voomWithQualityWeights() functions. Personally, I would use sa…
Votes
Awards
• All
Popular Question to
shepherl
4.2k
Popular Question to
Gordon Smyth
53k
Popular Question to
Hervé Pagès
16k
Popular Question to
Istvan Albert
▴
50
Locations
• All
WEHI, Melbourne, Australia, 33 minutes ago
United States, 40 minutes ago
United States, 1 hour ago
Canada, 1 hour ago
Barcelona, Spain, 3 hours ago
WEHI, Melbourne, Australia, 33 minutes ago
United States, 40 minutes ago
United States, 1 hour ago
Canada, 1 hour ago
Barcelona, Spain, 3 hours ago
Traffic: 2341 users visited in the last hour
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by the
version 2.3.6
version 2.3.6