Bioconductor Forum

effect on age.  I've been able to write snippets to find the min/max exprs (expression level) within the set... <pre> > min(exprs(ALL)) [1] 1.984919 > max(exprs(ALL)) [1] 14.12657</pre> ...but cannot seem to write a snippet that maps...this is tricky.  Each patient obviously has an age (which is a column) and also an expression level (which as I u…

ALL bioconductor biobase exprs

updated 7.3 years ago • detroit.drive

I'm not sure what Im doing wrong since I have used the code many times before the row names doesn't show up although that is assigned to in my code. I have tried putting the row-name both left and right side but it...100) myBreaks <- seq(-0.5, 0.5, length.out=100) myBreaks hmap <- Heatmap(heat, name="Z-score", col=colorRamp…

ComplexHeatmap

updated 3.5 years ago • krushnach80

Hello, I am trying to convert ensembl ids to gene names or gene symbol before analysis. How I will convert this? And how I convert in the results file from DESeq2 or EdgerR

ensemblid

updated 6.0 years ago • rajeshparmar4

Dear all, I am used to analyse RNA-seq data with the very useful and well-documented DESeq2 package. I have analysed an RNA-seq dataset containing 2 conditions (control and transgenic mice) with 3 replicates for the control condition and only 2 replicates for the transgenic one (we initially sequenced 3 transgenic samples but the quality of one of the sample was not sufficient and we therefore h…

deseq2

updated 10.7 years ago • celine

gt; From: Daniel Brewer <daniel.brewer at="" icr.ac.uk=""> > Subject: [BioC] How to check if gene name is an alias or misspelt > To: Bioconductor mailing list <bioconductor at="" stat.math.ethz.ch=""> > Message-ID: <49DCAC07.6010804

Cancer convert Cancer convert

updated 16.7 years ago • Gordon Smyth

chromosomal locations indicating genes but I don't know how I map this location into specific gene names. > head(pns) [1] "chr19:4205395-4220723" "chr16:73793547-73835933" [3] "chr22:18115791-18146966" "chr19:60540822-60563218" [5] "chr16

Lung charm genomes Lung charm genomes

updated 13.4 years ago • Yoo, Seungyeul

Not Found' Note: http://www.bioconductor.org/packages/data/annotation/stable does not seem to have a valid repository, skipping Warning messages: 1: Failed to read replisting at http://www.bioconductor.org/packages/data/annotation...Not Found' Note: http://www.bioconductor.org/packages/data/annotation/devel does not seem to have a valid repository, skipping Warning messages: 1: Failed to read rep…

cdf gcrma cdf gcrma

updated 18.7 years ago • Yi Xing

H3K4me3\_narrow) \#\#\# error massage: <span style="background-color:Yellow">_"Repeated column names found in count matrix"_</span> best sajjad   &nbsp

diffbind

updated 10.1 years ago • khani.sajjad

and use both the weight01 and elim methods for filtering GO terms. I built my gene list as a named numeric vector using all of the genes that were expressed in the data and then calculated a z score to define my genes...log10(de_matrix$padj))), 0.00) ## Make the gene list as a named numeric vector gene_list<-de_matrix$score names(gene_list)<-de_matr…

topGO

updated 19 months ago • adendekk

for microRNA mir\_track <- AnnotationTrack(microrna\_range, id="miR-150", genome="GRCh37", name="miR-150",                              showFeatureId=F, cex.title=1, fill="grey81...for promoter promoter\_track <- AnnotationTrack(promoter\_grange…

gviz

updated 9.3 years ago • just

file.exists(filename)) > h5createFile(filename) [1] TRUE > h5write(LETTERS, file = filename, name = "/LETTERS") > h5dump(filename) ## works OK $LETTERS [1] "A" "B" "C" "D" "E" "F" "G" "H" "I" "J" "K" "L" "M" "N" "O" "P" "Q"…

rhdf5

updated 11.1 years ago • friedmab

of eval=FALSE: 0 (0%) \* Checking version number...     Checking version number validity...     Package version 0.99.0; pre-release \* Checking R Version dependency... \* Checking individual file sizes... \* Checking...biocViews... \* Checking that biocViews come from the same category... \* Checking biocViews validity... \* Checking …

R

updated 7.6 years ago • topijush

10000L, 10000L, 10000L, 10000L, 10000L, 10000L, 10000L, 10000L) , NAMES = NULL , elementType = "integer" , elementMetadata = NULL , metadata = list() ) , strand = new("Rle" , values = structure(3L, .Label = c("+", "-", "*"), class = "factor...6.21, 0, 0, 0)…

rtracklayer

updated 10.4 years ago • liz.ingsimmons

Exon Rankings. If this is not what you expected, then please be sure that you have provided a valid attribute for exonRankAttributeName 2: In matchCircularity(chroms, circ_seqs) : None of the strings in your circ_seqs...Prepare the 'metadata' data frame ... metadata: OK Now generating chrominfo from available sequence names. No chromosome length information is available. Warning messages: 1: I…

updated 11.7 years ago • Guest User

Hi, I've been following the example for using __GOstats__ at its manual at __https://www.bioconductor.org/packages/release/bioc/vignettes/GOstats/inst/doc/GOstatsForUnsupportedOrganisms.pdf.__ Unfortunately I have an error <pre> <em>Error in initialize(value, ...) : invalid names for slots of class “GOHyperGResult”: pvalues, oddsRatios, expectedCounts, catToGeneId, organism</…

GOstat GOstats

updated 9.5 years ago • ccanchaya

You could use getBM function in >> biomaRt >> package to convert ensembl_ID to gene name or other IDs if needed. >> >> Best regards, >> >> Julie > > </pablo.echeverria></div

Annotation AnnotationData annotate convert biomaRt Annotation AnnotationData annotate

updated 14.9 years ago • Julie Zhu

0): assays(1): counts rownames(32833): AT1G01010 AT1G01020 ... ATMG09960 ATMG09980 rowData names(0): colnames(70): 1_1 1_2 ... 36_1 36_2 colData names(7): ID rep ... ds.DNA.Concentration..nM. SampleName</pre> This works, summarizing...version assays(1): counts rownames(32833): AT1G01010 AT1G01020 ... ATMG09960 ATMG09980 rowData names(0): colnames(70): 1_1 1_2 ... 36_1 36_2 colDat…

deseq2 hdf5 rangedsummarizedexperiment rnaseq

updated 8.4 years ago • Jakob Petereit

output to be A B [1,] 2.5 10 [2,] 3.5 11 [3,] 4.5 12 I can do this by looping through each level of the column name, but I was wondering if there is a function for calculating the average of replicates in one step. Thank

updated 14.7 years ago • Wendy Qiao

<div class="preformatted"> The Center for Bioinformatics and Molecular Biostatistics in the Department of Epidemiology and Biostatistics at UCSF seeks applications for a faculty position. Appointment is at the Assistant level in the Adjunct series. Duties: Liaise with clinical and translational investigators who utilize genomics and/or proteomics technologies in their research, with involv…

Proteomics Proteomics

updated 19.1 years ago • Fridlyand, Jane

permutation analysis for amplicon data but it is giving distance according to ASV instead of sample names, please help me with it. > werra_sp <- read.table("convent.fert.root.count.txt",header=T,sep='\t',check.names=F,row.names...data.frame': 18 obs. of 2 variables: $ Treatment: Factor w/ 1 level "convent.fert.": 1 1 1 1 1 1 1 1 1 1 ... …

vegan

updated 6.4 years ago • nabiyogesh

Quality control ``` Now, I have been using "a character vector with exactly three elements: the name of a factor in the design formula, the name of the numerator level for the fold change, and the name of the denominator level

DESeq2

updated 4.7 years ago • TJ

df2$Y, start = df2$BP, end = df2$BP+1, chromosome = chr, genome = gen, groups = factor(df2_trait,levels = c(df1_trait, df2_trait)), name="Log10P", legend=TRUE) dtrack <- DataTrack(data = df1$Y, start = df1$BP, end = df1$BP+1, chromosome = chr...genome = gen, groups = factor(df1_trait,levels = c(df1_trait, df2_trait)), name="Log10P", legend=TRUE) overlapTracks <- OverlayTrack(tra…

gviz gviz-package

updated 7.8 years ago • p1990

by using code below, do I isolate fungal colonization-associated plant genes in my reference level (here WT) or in all samples?** ``` res <- results(dds,name = "Fungal_biomass") summary(res$padj < 0.05 & res$log2FoldChange >1...22596 410 ``` I thought I isolated colonization-induced genes in WT because it's the reference level, but 410 is much less than the numb…

Contrast design DESeq2 continuous

updated 4.0 years ago • tiansy

<div class="preformatted">this is what you have to do. in the exprs (intensity) slot of an AffyBatch put a matrix with as many columns as arrays and as many row as number of probes on the array. in each column put the vector of intensities of each array. a row must represent a unique location on the array. no you need to create a hash table enviromnet with varialbles with names of the prob…

Normalization cdf probe Normalization cdf probe

updated 22.8 years ago • Rafael A. Irizarry

I thought I saw a mention on the mailing list that coverage and similar functions would support a named vector for providing the width instead of just a list. The documentation states so too: For RangesList and RangedData...the same length as ?x? to be used for the corresponding element in ?x?. However, using a named vector does not work (my aln.ranges is a RangesList object): &g…

Coverage Coverage

updated 13.4 years ago • delhomme@embl.de

the "whiskers". The main box and whiskers themselves *appear* to be the same. I guess some defaults must be different when defining the data as a formula or explicitly naming the vectors... but I'm not finding an obvious note as

limma limma

updated 19.4 years ago • J.delasHeras@ed.ac.uk

wanted to modify hyperGTest for my project, but I cannot seem to find > any relevant code. There must be some secret to names for functions > for this type of thing - please point me in the right direction. As Jim pointed out

GO Cancer GOstats Category GO Cancer GOstats Category

updated 18.6 years ago • Seth Falcon

GenomicRanges" package to generate "GRanges" objects, but I would like these objects to have "REFSEQ" names rather than UCSC-style names.  This gives me UCSC-style names:  library(OrganismDbi) a1 <- promoters(Mus.musculus

promoter granges refseq ucsc organismdb

updated 10.0 years ago • efoss

I have conducted an analysis differential expression analysis using edgeR, but am receiving some criticism of the design of the statistical tests.  I am hoping someone can either verify that the approach I have taken is valid, or that I should be doing the type of analysis that has been suggested.  Some background on the experiment: I am interested in gene expression changes wh…

edger limma

updated 10.6 years ago • jbono

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20070731/ 2df773a1/attachment.pl</div

updated 18.4 years ago • Alex Tsoi

Hi, I am trying to plot some data in R using the Gviz package, but I can't seem to get the gene names to appear on the track nor can I get the ideogram function to work. For the ideogram, I am aware that the yeast genome does...chromosome = chr) Error in .local(.Object, ...) : Failed to obtain 'hguid' cookie ``` For gene names, I would like to have them on top of the yellow bars indi…

gviz Saccharomyces_cerevisiae Gviz ideogram

updated 2.2 years ago • Michael

this script  --- out <- lapply(df, function(x) pairwise.wilcox.test(d\[\[x\]\], d$group)) names(out) <- names(d) out --- I keep getting the error  <span style="line-height:1.6">> out <- lapply(df, function(x) pairwise.wilcox.test...span> Error in .subset2(x, i, exact = exact) :    recursive indexing failed at le…

wilcoxon signed rank test data frame affy

updated 9.9 years ago • Smeeta Shrestha

by Xiaogang Zhong, Leslie Cope, Elizabeth Garret and Giovanni Parmigiani. The package is named 'MergeMaid', and it should be available to the public tommorow morning (Eastern US time) Package: MergeMaid Version: 2.0...functions use the output from 'modelOutcome' to graphically display the results and cross-validate associations of gene expression data with survival. Depends: R (…

Survival Survival

updated 21.5 years ago • Jeff Gentry

gt; Error in vL[[i]] : subscript out of bounds ok, but a better approach is to introduce a validity checking method to prevent such phenoData objects from ever being created see setValidity under methods we need...vL <- object@varLabels > cat("\t varLabels\n") > nm <- names(vL) > for(i in 1:length(vL) ) &g…

updated 23.7 years ago • Vincent J. Carey, Jr.

accepted\_hits\_selected.bam ...  Execution halted We've discovered that the database names are changed, while in the biomaRT package they did not update those names...   Can anyone please help us? &nbsp

biomaRT database

updated 10.8 years ago • aspadotto

length 16576709 bytes (15.8 MB) downloaded 15.8 MB Error in unzip(basename(bin)) : invalid zip name argument In addition: Warning message: In if (grepl("^https?://", url)) { : the condition has length > 1 and only the first element will

tcgabiolinks gdcdownload unzip

updated 7.9 years ago • fawazfebin

Authorization Required' Note: http://www.bioconductor.org/CRANrepository does not seem to have a valid repository, skipping Warning message: cannot open: HTTP status was `407 Proxy Authorization Required' Note: http://www.bioconductor.org...repository/release1.2/package does not seem to have a valid repository, skipping Warning message: cannot open: HTTP status was `407 Proxy Authorization Requir…

updated 22.2 years ago • Arne.Muller@aventis.com

up and down regulated genes, but when I run it it says: Error in `check_aesthetics()`: ! Aesthetics must be either length 1 or the same as the data (499): colour This is my code: ``` keyvals <- ifelse(p$log2FoldChange < -0.5 & p$padj...gt; 0.5 & p$padj > 0.05, 'mediumpurple', "black")) keyvals[is.na(keyvals)] <- 'black' names(keyvals)[keyvals == 'dar…

EnhancedVolcano

updated 3.1 years ago • patrirodry85

Error in .testForValidKeys(x, keys, keytype, fks) : None of the keys entered are valid keys for 'SYMBOL'. Please use the keys method to see a listing of valid arguments. > The same when `ALIAS` is used... > AnnotationDbi...Error in .testForValidKeys(x, keys, keytype, fks) : None of the keys entered are valid keys for 'ALIAS'. Please use the keys method to se…

org.Hs.eg.db

updated 13 months ago • Guido Hooiveld

of the new, subset object; the phenoData slot that has been used to subset *seems* to still have 3 levels, whereas I expect only one level. This behaviour also occurs for the other variables of the phenoData dataframe (i.e...data :'data.frame': 120 obs. of 5 variables: .. .. .. ..$ Simil : Factor w/ 10 levels "i1","i10","i2",..: 1 1 3 1 1 3 1 1 3 1 ... .. .. .. ..$ Diet …

GO convert GO convert

updated 13.9 years ago • Guido Hooiveld

Hello! I am having issues with updating package 'curl.' Specifically, when performing ```BiocManager::valid()```, I obtain the standard advice to run the command: ```BiocManager::install("curl", update = TRUE, ask = FALSE, force = TRUE)``` Doing so performs...I am having issues with updating package 'curl.' Specifically, when performing ```BiocManager::valid()```, I obtain the standard advic…

curl HELP

updated 8 months ago • kagodwi2

I remember there is a website where you can type in affy probe set ID and it will give you the gene name, could anybody tell me what it is? Thanks, -James [[alternative HTML version deleted]] </div

probe affy probe affy

updated 15.7 years ago • James Anderson

TRUE, sep = "\t") ## List Salmon directories salmonfiles <- paste0(salmondir, "/", metadata$names, "/quant.sf") names(salmonfiles) <- metadata$names ## Add file column to metadata and import annotated abundances ## In transcript...level coldata <- cbind(metadata, files = salmonfiles, stringsAsFactors = FALSE) st <- tximeta::tximeta(coldata) # When I run the last...s…

tximeta

updated 4.0 years ago • atariw

when running an example from the vignette.... Apparently `` 'go_id' `` nor `` 'go' `` are good names for the GO filter anymore....? I would appreciate some assistance with this. Thanks, Guido   <pre> library("biomaRt") ensembl...nbsp; :   Invalid filters(s): go_id Please use the function 'listFilters' to get valid filter names # listFilters finds this gene ontolo…

biomart gene ontology GO

updated 7.2 years ago • Guido Hooiveld

lt;- unlist(promoter.seqs)> promoter.seqs A DNAStringSet instance of length 8 width seq names [1] 1500 CTGCTGTAAAGTTACATTCCTGCCTAGAAATTTATATCGA TTCTGCCGTCAGAA...GGAGGGAAGCGCCGGGCTGTGTCACGTGACGGGTGCGCCGGGCGTTGGCTCCT

updated 11.3 years ago • deepti anand

when trying to execute one of the examples from its own documentation (from page 5 of the vignette) Namely, the following code exactly reproduces the crash:   pcms  <-  readPCM(file.path(find.package("motifStack...replaceEntities), as.logical(asText), as.logical(trim),     as.logical(validate), as.logical(getDTD), as.logical…

motifstack

updated 9.8 years ago • map2085

until I reach a certain point in my list [812] and then I get an error saying that the key is not valid. As far as I can tell there's nothing wrong with the gene ID. It is the same format as all the others and I looked it up in tair...I hope it's clear enough. The first section is not very relevant as I'm just matching P.patens gene names to Arabidopsis homologue IDs before retrieving the info fr…

org.At.tair.db

updated 4.4 years ago • Zoe

values are being converted to a factor upon import and then coerced to numeric (giving the factor level, not the original value). If I use options(stringsAsFactors=FALSE) the values remain intact. Best regards, Tim Rayner -- Bioinformatician...snp 189807684 189807684 0.20294398632582 * . ID=rs955894;name=rs955894 chr1 rtracklayer snp 198484784 …

SNP rtracklayer SNP rtracklayer

updated 13.4 years ago • Tim Rayner

the total transcript-- concatenation of all exons from a gene. DegNorm follows the HTSEQ to define a valid read to be one that completely sit "within" the exon regions. In DegNorm package, defined a function to calculate the read...results=.IntersectionStrict2(genes,gal2) tx2reads <- setNames(as(t(results), "List"), names(genes)) ## calculate read pair read_counts=d…

DegNorm GenomicAlignments

updated 3.6 years ago • Jiping Wang

value of 'files' before using the read.maimages() function. Does 'files' contain the required file names? Please read ?read.maimages to see what format 'files' must be in. Gordon >thanks </gusnahab></div

limma limma

updated 20.3 years ago • Gordon Smyth

quality assessment. In order to do that, I've created a SpotTypes.txt file: <pre> SpotType ID Name Color ncRNA * * black Blank *Blank* * pink PosControl *hsa* * blue NegControl *Randomer* * red</pre> loaded it through readSpotTypes...for: Error in matrix(unlist(value, recursive = FALSE, use.names = FALSE), nrow = nr, : 'data'…

limma custom stf

updated 10.2 years ago • dario.veneziano

produce this error: <pre> Error in `colnames<-`(`*tmp*`, value = c("Chr", "Start", "End", "Conc", : 'names' attribute [9] must be the same length as the vector [7]</pre>   Furthermore, the same samples are (as you see in my contrast

diffbind

updated 8.6 years ago • j.bergenstrahle

Hi Everyone!! I am trying out a Package `Gviz` to make chromosome-wise coverage plot for a genome sequencing experiment. I was planning to plot per-chromosome-multi-sample coverage plot as shown below. ![enter image description here][1] For that I have written a function that does that but now I wish to loop over that function and iteratively save the pdf. But I am unable to achieve that. ``…

Gviz

updated 3.4 years ago • rohitsatyam102

arabidopsistlgf4xcdf not available ********* So I made copy of "arabidopsistlgF.cdf", and change name "arabidopsistlgF4x". And continue, > env = make.cdf.env("arabidopsistlgF4x.cdf") > cel.files=list.files(pattern=".CEL...port 80. Note: http://www.bioconductor.org/repository/devel/package/Source does not seem to have a valid repository, skipping Warning messages: 1: Failed to r…

Normalization cdf affy makecdfenv Normalization cdf affy makecdfenv

updated 20.6 years ago • Junshi Yazaki

c("sire", "dam")) Error in .subset2(x, i, exact = exact) : recursive indexing failed at level 2 > sessionInfo() R version 2.15.1 (2012-06-22) Platform: x86_64-pc-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC

Genetics GeneticsPed Genetics GeneticsPed

updated 12.4 years ago • Liz Hare

5)) R> findOverlaps(x, ignoreSelf=TRUE, ignoreRedundant=TRUE) Error in checkSlotAssignment(object, name, value) : assignment of an object of class "integer" is not valid for slot "matchMatrix" in an object of class "RangesMatching

Cancer BSgenome BSgenome Cancer BSgenome BSgenome

updated 15.6 years ago • Steve Lianoglou

229)">Error in useDataset("pathway", mart = reactome) : The given dataset: pathway , is not valid. Correct dataset names can be obtained with the listDatasets function.</span></strong></pre> <pre> <span style="background-color

biomart REACTOME

updated 11.1 years ago • jz6002

I'm trying to use the NanoStringDiff package to perform a differential gene expression analysis However, when I try to construct the data set with the function NanoStringData = createNanoStringSetFromCsv(path, header = TRUE, designs), I keep receiving the error message "Error in rowSums(counts) : 'x' must be numeric" Here it follows a section from my datasheet: ``` Name Accession Neg…

Bioconductor Transcriptomics NanoStringDiff

updated 5.1 years ago • Pedro

div class="preformatted"> I am having a problem with bead level data. I have .txt files containing over 900,000 lines with four columns: Code, Grn, GrnX and GrnY. The image files are .jpg rather

geneplotter affy affyio beadarray quantsmooth beadarraySNP geneplotter affy affyio

updated 18.4 years ago • Krys Kelly

I want to annotate gene names for a segmented file by finding overlap with it with a reference file. Would like to know how can it be done using

annotation

updated 10.5 years ago • seeker