Bioconductor Forum

Hi, I am trying to find out length of Yeast ORF. Where is my mistake? <pre> > sacCer3Length <- function(symbols) { require(TxDb.Scerevisiae.UCSC.sacCer3.sgdGene...require(org.Sc.sgd.db) exons.db = exonsBy(TxDb.Scerevisiae.UCSC.sacCer3.sgdGene, by='gene') egs = unlist( mget(symbols[ symbols %in% keys(org.Sc.sgd) ],org.Sc.sgd) ) sapply(egs,function(eg)…

yeast genomicranges

updated 11.2 years ago • dktarathym

nbsp; I am using DEXSeq so far without any problem. But I am interested in normalized counts by length in dexseq plot. Therefore, I assume i will get considerably less fluctuated expressions across exons. To do that...pre> Well, it worked for some cases, but for some cases i have following error; <pre> Fit for gene/exon ENSG00000182718 failed, coefficients for this gene won'…

dexseq plotdexseq

updated 8.1 years ago • tanerarslan.gen

enter image description here][1] I generated a custom annotation using IsoQuant and long-read sequencing data. I did not find any missing gene names or placeholders within the custom annotation. This is from a 2X2 RNA-sequencing...experiment looking at gene expression in the deer mouse placenta. featureCounts -O -M --fraction -p -F GTF -t transcript -T 24 -a OUT.extended_annotation.gtf

featureCounts Rsubread

updated 7 months ago • Meg

The exons were selected and the list contains only ~ 10.000 of them. 2) Using getSeq I fetched sequences of certain length upstream from the exon and downstream which are appended into columns for every given exon. Up...em>Warning message: In valid.GenomicRanges.seqinfo(x) : 'ranges' contains values outside of sequence bounds. See ?trim to subset ranges.</em></strong></pre…

granges

updated 11.1 years ago • piotr.grabowski

On Apr 30, 2009, at 11:59 , Pete Shepard wrote: > Dear List, > > Does anyone know if the sequences generated using mrna seq protocol > fro Wang > and Burge Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, Mayr C, &gt...GP, Burge CB. (2008). Alternative Isoform > Regulation > in Human Tissue Transcriptomes. Nature *456,* 470-476. Full &g…

updated 16.7 years ago • Kasper Daniel Hansen

and hence ambiguity) between isoforms. This is why voom has only  ever been recommended for gene-level data."  My understanding is that there is both reduced power and increased false discoveries when all isoforms...I would run voom separately for these groups. I think that a similar issue arises for us at the gene level. Our data were generated with deep sequencing (libra…

isoform deep sequencing voom

updated 5.4 years ago • Ina Hoeschele

back. I have a DNAStringSet object for which I'd like to randomize the order of nucleotides in the sequences. Here is a simple example: # function to randomly re-order a string randomizeSeq <- function(mystring){ # split the string...mystring),'')) # randomize the order of characters random.myChars <- sample(myChars,length(myChars)) # concatenate them back into a string…

BSgenome BSgenome BSgenome BSgenome

updated 12.8 years ago • Chris Seidel

human cancer samples and want to insert their genetic variations into the reference proteome fasta sequences to increase the sensitivity of my peptide/protein quantification. **Can you implement this "proteomeVariantInsertion...On `customProDB`: In principle the package customProDB is already doing this job. But from 11,000 genes with ~40k non-synonymous SNVs that were extracted using Variant…

VariantAnnotation customProDB

updated 6.9 years ago • daniel.magnus.bader

dear Ken, the selection for a particular P value in the topTable of affylmGUI and the selection of genes differentially expressed in the vennDiagram of affylmGUI show different numbers. This is most likely of no surprise...function() - { - Try(opar<-par(bg="white")) - Try(vennDiagramaffylmGUI(vc,include=include,names=as.vector(setNames), cex=0.85,mar=rep(1,4))) - Try(TempGraphPar&a…

affylmGUI affylmGUI

updated 20.6 years ago • Steffen Moeller

find enriched GO terms for zebrafish RNA- seq data and am looking for advice on manually providing gene length information and GO annotation to goseq. My RNA-Seq data is mapped to danRer7 Ensembl gene id's. Unfortunately danRer7...does not appear to be supported by goeqs's built-ins for ensembl gene ids. > supportedGenomes () [68,] db species date name…

Annotation GO zebrafish goseq Annotation GO zebrafish goseq

updated 13.4 years ago • Ravi Karra

Q. et al. NAR 2011 (Large-scale prediction of long non-coding RNA functions in a coding-non-coding gene co-expression network) and want to select the genes with "expressional variance ranked in the top 75 percentile of each...DESeq2 (recommended as input for the WGCNA package), but I am unsure how to proceed to select the genes with highest variance. My matrix consists of datasets representing di…

geneexpression wgcna rnaseq

updated 11.3 years ago • Jon Bråte

regarding Poisson noise or shot noise with respect to differential expression analysis of digital gene expression data. As an example, if one source of RNA was made into 7 identical RNA-Seq libraries and then sequenced on 7 individual...lanes, when comparing the sequence data we would still expect differences between the gene counts due to shot noise. Using the rpois() function I generated...68-…

updated 13.9 years ago • Dave Tang

div class="preformatted">Hi. I have come accross some errors when linking probe IDs with gene symbols. In most cases the probe ID retrieves the corredct gene symbol, however the following probe IDs should correspond...to CD4 antigen, CD4 anitigen, and FCGR3A respectively. genes<-c("203547_at","216424_at","204006_s_at") symbol<-multiget(genes,env=hgu133aSYMBOL) symbol $"2035…

probe probe

updated 22.2 years ago • Anthony Bosco

Hello, I am using topGo for customized background enrichment analysis. i made background file by names of genes and their corresponding GO IDs. I can do fisher's teat and every thing mentioned in the manual. I want my result...table correspond to gene name not GO IDs. I found a code to find genes against GO ids myterms = c("GO:0007610", "GO:0014070", "GO:0045910") mygenes <- genesI…

customannotation enrichmentanalysis topGO

updated 5.0 years ago • Aini

Hello everyone . I have a count matrix of sequencing data showing how many fragments there is in each region here is a few rows of my data head(data[,1:6]) [,1] [,2] [,3] [,4] [,5] [,6] 1 3 6 0 0 3...Hello everyone . I have a count matrix of sequencing data showing how many fragments there is in each region here is a few rows of my data head(data[,1:6]) [,…

Normalization cqn

updated 5.1 years ago • pegah.taklifi

Dear all, I am trying to extract the canonical coding sequence for a given gene. When using getBM I get a list of several sequences. Is there a way to filter them so I only get the canonical...sequence? Thank you all for your help! ```r library(biomaRt) mart <- useMart('ensembl', dataset = 'hsapiens_gene_ensembl', host = 'useast.ensembl.org

Bioconductor biomaRt

updated 5.0 years ago • heiko_kin

Hi :) This seems like a simple enough question but I can't find a straight answer... I have a fasta alignment of 65 sequences, all of them exactly the same length (roughly 40 000 bp long). The fasta alignment looks like: >seq1 AAATTTCCCGGG >seq2 CAATTTCCCGGG >seq3 CAAGTTCCCGGG The output I am looking for is the exact number of dissimilarities be…

pairwisealignment SNP dnasequence

updated 8.9 years ago • lordbleys

Has anyone an idea why some of my results from a DESEQ2 analysis have empty pvalue and padj value. Most of the genes have a pvalue and padj but for some genes for a reason I dont understand they are completely empty. In case the...value is 0 for other genes it would show a "0". So empty seems not to be equal to zero. Example: log2FoldChange | pvalue | padj ---…

DESeq2

updated 4.8 years ago • Bine

<div class="preformatted">Hello,       I have following sequences for which I want to BLAST and see result only for sequences showing > 95% Query coverage and >90% identity? Sequences >1 CTTTGTCTTCCCCTATGTCATCCTCAATCTCTATGAAAGCAACAC >2 CTATGTCATCCTCAATCTCTATGAAAGCAACACCGCTACCATAGA Can you please Suggest how can I select them in R in N…

Coverage Coverage

updated 11.7 years ago • prabhakar ghorpade

Hello! I have an experiment involving the comparison of protein abundance of drug-treated cells with the control group for the course of 1, 2, 3, 4 and 5 hours. As I understand, the "9.6.2 Many time...Either Treatment or CNTR ``` and times is: ```r times <- ns(experimental_design$time, df=4) # Natural splines based on a column with 1/2/3/4/5 hour indicator ``` Afterwards, I fit …

limma

updated 22 months ago • dl17032000

and produce one promoter per list element. > transcripts[1] GRangesList object of length 1: $ENST00000496973.5 GRanges object with 6 ranges and 3 metadata columns: seqnames ranges strand | exon_id exon_name...169804112-169804347 + | 26038 ENSE00001838164.1 6 ------- seqinfo: 25 sequences (1 circular) fro…

GenomicRanges

updated 5.5 years ago • Dario Strbenac

<div class="preformatted">Hi, I work with dual channel technology and I would like to use limma for two way analysis. My experiment is as follow: FileName Cy3 Cy5 GL_251322310100_S02_.gpr WT3h NI3h GL_251322310101_S02_.gpr WT3h NI3h GL_251322310103_S02_.gpr Mut3h NI3h GL_251322310104_S02_.gpr Mut3h NI3h GL_2513…

limma limma

updated 20.3 years ago • Ron Ophir

calculated from off-target analysis, and how is it different from the one calculated from the input sequence?  Does either correspond to the Rule Set 2 scoring methods in [Doench, Fusi et al., Nature Biotechnology 2016

crisprseek

updated 8.2 years ago • joyce

I'm trying to read the data of GSE81608 from GEO, but I can't see the gene names. I tried both by reading the CSV file, and by using GOEquery from R. It looks like the gene names are not available. (the...CSV just marks the genes by a running number) Is it possible that the dataset was published without the gene names? or am I missing something

geo

updated 8.5 years ago • yuvallb

I have two DNA sequences with two overlaps (one 557 bp long and one 140 bp long). Both overlaps are exactly the same between the DNA sequences...However, that function returns always only one overlap, the first found one (in my case, the one of length 557 bp). Is it possible to find both overlapping sequences and their lengths? For example: DNA1: ATCGTTTAAGCCCGGTTATAC...DNA2: ATCGTTTAAGCCCGGTTA…

biostrings pairwisealignment

updated 8.0 years ago • kgorczak

Dear all, I want to align circular sequences (plasmids, > 10000 bp) to check if they are identical or to see where they differ. Due formatting by other software...sequences do not necessarily start at the same position. But other than different starts they may be identical. The sequences...for such problem? I believe the DNAString oder DNAStringSet does not handle circular sequenc…

Biostrings

updated 3.9 years ago • vonSkopnik

Dear bioconductor support members, I have been struggling with the interpretation of differential abundance estimates as output from the diffcyt package. Specifically, I want to use the testDA_edgeR to identify differentially...abundant cell populations in single cells cytometry data from ~100 samples between ~10 subgroups. While I am able to compute...is shown, which I am assuming indicates w…

limma diffcyt edgeR

updated 3.7 years ago • stefanos.bamopoulos

illumina 450K arrays. I have a list of differentially methylated positions that I want to convert to gene names, or something useful. There's no information on annotation in the minfi manual, but I can get the sequence from 'IlluminaHumanMethylation450kmanifest...like it should help me do what want. If I understand correctly, all I have to do is convert my sequence to a nuID, and then conver th…

Annotation convert minfi Annotation convert minfi

updated 13.7 years ago • Ed Siefker

data. I have run RGI of the assembled reads using CARD as the database. Now I want to calculate the abundance of the antibiotic resistant genes (ARGs) in the resulting .tsv files. Could you kindly share the method used to calculate...the relative abundance of ARGs like a pipeline or something OR any video links that might be of help. Hoping to hear from you all. Thanks and

Metagenomics abundance

updated 3.2 years ago • YASIR

overlaps Warning messages: 1: In .Seqinfo.mergexy(x, y) : The 2 combined objects have no sequence levels in common. (Use suppressWarnings() to suppress this warning.) 2: In .Seqinfo.mergexy(x, y) : The 2 combined objects...have no sequence levels in common. (Use suppressWarnings() to suppress this warning.) 3: In .Seqinfo.mergexy(x, y) : The 2 combined objects...have no sequenc…

FourCseq

updated 10.5 years ago • dzis

<div class="preformatted">Dear group, I have 2 questions to ask: Question 1: Give a pathway name for KEGG, how do I get all the genes involved in that pathway. >library(KEGG) >wnt <- get("04310", KEGGPATHID2NAME) now how do I get gene names in wnt pathway. Here I am not interested in taking say HGU133a chip and map all probeset ids to wnt. I just need genes in wnt.…

hgu133a hgu133a

updated 18.8 years ago • Srinivas Iyyer

are operational taxonomic units), so I have a 3074 x 12 matrix. A lot of the features have very low sequence counts. I thought that I won't get reliable inference from these anyway, so it's better to remove them to decrease the...resulting 784 x 12 matrix into DESeq2. The result was that no features had significantly different sequence counts in the two sample groups. Out of curiosity, I prepared…

deseq2

updated 9.5 years ago • szoboszlay.m

nbsp; Hi I am trying to work out how to relate basepair position information in unaligned sequence to aligned sequences in pairwiseAlignment objects. So if I have a feature in my initial unaligned pattern or subject...sequence at 100-110 bp I would like to be able to identify where this in the aligned sequence taking into account any indels

pairwisealignment indel

updated 9.5 years ago • oliwindram

tissue is notorious for outliers - it may be the form of an outlier sample, but outlier genes (where the responsible sample always changes) is also typical and expected. This is neither pretty nor clean data to...PCA showed one outlier subject which was removed, however, outlier (extremely high) counts for genes here and there coming from different subjects each time is proving to be a problem fo…

DESeq2 DEG

updated 3.3 years ago • marinaw

div class="preformatted">Dear Bioconudctor, I have this question about how to compress the gene expression dataset from probe sets denoted to gene denoted values. The analysis has two simultaneous goals, first is...to convert the probe sets to gene names. Second is to convert the probe sets values into just one summary gene expression value of the associated gene. For...gene? Another ques…

Annotation probe convert ASSIGN Annotation probe convert ASSIGN

updated 15.1 years ago • Xiaowei Guan

Hello, I am trying to calculate the Fragment Length and Relative Cross-Coverage for a sequencing experiment using a non-model microbe. DNA was sheared to ~300bp during...library prep, used single-end library sequencing, and my peaks were called using Mosaics in R (fragment length 300, bin size 200). I used the [information here][1] and [here...0) hha <- list(version="", …

ChIPQC software error

updated 6.4 years ago • ryleehackley

Hi, I think I found a bug, not sure I am right or not. <pre> library(TxDb.Hsapiens.UCSC.hg19.knownGene) UCSC.hg19<- TxDb.Hsapiens.UCSC.hg19.knownGene hg19.genes<- genes(UCSC.hg19) library("org.Hs.eg.db") gene_symbol<- AnnotationDbi::select(org.Hs.eg.db, keys=hg19.genes$gene_id, columns="SYMBOL", keytype="ENTREZID") …

txdb.hsapiens.ucsc.hg19.knowngene

updated 9.2 years ago • tangming2005

I am using ChIPpeakAnno package, after calculating the motif of the fasta sequences of the peaks I called, I realize there are two pfms in the results, one is of 6 bases, while the other is of 8 bases. In tutorial...tidyverse) library(EnsDb.Hsapiens.v86) annoData <- toGRanges(EnsDb.Hsapiens.v86, feature = "gene") library(TxDb.Hsapiens.UCSC.hg38.knownGene) library(UpSetR) library(org.H…

ChIPpeakAnno ChIPSeq MotifDiscovery

updated 2.3 years ago • franciscrick41

years ago, part of the old annotation > (GPL1449) should be out of date. If we map the probe sequences to most > updated RefSeq RNA database and re-analyze the data, we may find some more > interesting genes. So we don...If there is not an answer to this problem, could you please tell how I can > download the probe sequences with the original probe ID? The bioconducto…

Annotation h20kcod probe Annotation h20kcod probe

updated 17.8 years ago • Sean Davis

the statistical challenges posed by modern genetic data. Prerequisites are minimal, and the modular nature of the Institute enables participants to design a program best suited to their back- grounds and interests. Most participants

Genetics Genetics

updated 13.9 years ago • Stephanie M. Gogarten

<div class="preformatted">Hi, I am using KEGGprofile to perform KEGG enrichment for a non model organism. Using the data from the R documentation i perfectely obtaine the enrichment. >data(pho_sites_count) >genes<-names(rev(sort(pho_sites_count[,1]))[1:300]) > summary(genes) Length Class Mode 300 character character > is.vector(genes) […

KEGGprofile

updated 11.3 years ago • artur

div class="preformatted">Hi everyone, Is there a way to map an Entrez ID to a gene symbol using the bioconductor annotations? I would've expected that to be in the xxxLLMappings annotations (I'm looking...not. I'm matching a couple of lists from different sources (including custom cDNA). Human-readable gene symbols make it a lot easier to deal with those lists. There are a couple of other w…

biomaRt biomaRt

updated 19.2 years ago • Francois Pepin

Hi Michael, I have treated vs untreated(wt) samples. And I know a subset of genes are very lowly expressed in wt but will be up-regulated in treated samples. When I do the DEseq2 analysis, most of them are...them by adjust p values or by fold change which makes sense. But in this case, it looks like the genes ranking at the top (high pvalue or foldchange) will bias to genes lowly expressed in wt…

DESeq2

updated 4.6 years ago • jasonwufree2012

Inf `` and `` cooksCutoff=FALSE `` and it actually increased the number of DE genes.  Here is the sample code <pre> dds <- DESeqDataSetFromMatrix(countData = countsMatrix, colData = colData, design = ~ type...span style="line-height:1.6">The big difference between deseq and deseq2 is there thousands of DE genes, even with 0.01 FD…

deseq2

updated 11.1 years ago • Prasad Siddavatam

div class="preformatted">Dear All, When using edgeR for differential expression of RNA-Sequences, I do not get any differentially expressed sequences (FDR <= 0.1). The R code is attached. Note that we have 5 libraries...5 FDR.cutoff <- 0.1 grpInput<-c(1,1,1,2,2) readsfile<- "inputMatrix" # The 1st row is the sequence reads<-read.table(readsfile,header=FALS…

edgeR edgeR

updated 13.3 years ago • Idit Buch

Hi everyone,   I am looking for some package with functions able to predict whether a sequence (or set of sequences) contains an intrinsic transcription terminator, with R. I could not find any package. An terminator

r

updated 8.7 years ago • g.nocchi

I am trying to get mm10 gene annotations with gene names. I have tried the following: <pre> ncbiRefSeq = makeTxDbFromUCSC(genome="mm10", tablename="ncbiRefSeq...makeTxDbFromUCSC(genome="mm10", tablename="knownGene")</pre> In the first two cases, I get no gene names: `` Type of Gene ID: no gene ids `` In the third case (knownGene), I get Entrez Gene ID numeric identifiers. Is there…

GenomicFeatures makeTxDbFromUCSC

updated 7.5 years ago • warrena

with QSEA. For transformation to beta-value, as well as for normalisation to NRPM, a factor called "sequencing preference" is mentioned. However, I don't fully understand what this sequencing preference is about. It can be calculated...not run smoothly for me, anyway). > Could you explain to me the underlying background of the sequencing preference? Is the sequencing preference conside…

qsea

updated 2.9 years ago • a.riediger

about organising my data for DESeq2 - to do RNAseq analysis. How do I not include my first column (gene ID) for my rawcount data as I am unable to cross check my metadata rownames with my rawcounts column names using the following...command: >all(rownames(metadata) == colnames(rawcounts)) longer object length is not a multiple of shorter object length Please help. Thanks

deseq2

updated 5.7 years ago • angkoo

Dear All,    I am doing an analysis on human  primary cell samples +/- treatment.  Due shortage of cells we constructed the library from pg RNA  as starting material plus the sequencing returned very low counts for most of genes.  I  extracted the protein coding genes from the matrix . However,  the default method for size…

deseq2 estimatesizefactors

updated 8.1 years ago • Lauma R

Hi everyone,  This is the code I used to create a volcano plot: I am trying to plot several genes and highlight the top 20 most downregulated and top 20 most downregulated genes using green and red. <pre> #Plot a volcano...logFC, -log10(P.Value), labs=SYMBOL, cex= .8, offset = 0.8))</pre>  However, I get overlapping gene labels. Is there anyway to avoid this? I k…

R

updated 8.2 years ago • Nithisha

redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. Natural language support but running in an English locale R is a collaborative project with many contributors. Type 'contributors...S3 methods will not likely be found > liftOver(test.GRanges, chain) GRangesList object of length 1: [[1]] GRanges object with 1 range and 0 metada…

rtracklayer

updated 4.7 years ago • nick.shrine

Hi, I wondering if anybody can hep me to generate masked (by RepeatMasker for instance) sequences. I'm currently using Bsgenome to extract sequence from a BED file such as : library(BSgenome.Hsapiens.UCSC.hg18...of="">) : no method for assigning subsets of this S4 class Is there a way get the masked sequence with the getSeq function ? Thanks. ------------------------------------------ E…

BSgenome BSgenome BSgenome BSgenome

updated 16.0 years ago • Mercier Eloi

I've noticed that there are a lot of genes (>1/3 of total) which have names and/or symbols in NCBI that are not in the reference annotation files. The oviAri4.ncbiRefSeq.gtf...GENEID, "LOC")) %>% unique() ``` Then I query each against the NCBI database and extract the gene symbol ("name") and the gene name ("description"). ``` for (i in 1:nrow(LOC_only)){ tryCatch({ e_name &…

Annotation RNAseq

updated 4.7 years ago • Chris

not to R. I was wondering if anyone had experience using DESeq2 to analyze the long read, direct RNA sequencing results generated by the MinION. I have attempted to use minimap2 to align the reads (due to customized parameters...to take them into DESeq2, which is favored by my colleagues. However, they use the more traditional sequencing platforms. I was able to read in the gene model and use sum…

deseq2

updated 6.7 years ago • uhlkatie

will make a profile plot of a certain distance from a single point. Is there something similar for gene body profiles? It's a similar idea, but instead of a single point, it's a variable length region in the middle, so you have to...normalize for length. Here is an example of both types of plots in case I am not clear: <img alt="" src="http://liulab.dfci.harvard.edu/CEAS/pic/figure6.jpg

chipseeker visualization

updated 9.6 years ago • igor

I'm right now working with a RNA-seq raw count data file (in .txt format). It's a matrix of ~50,000 genes (row) and 8 samples (column). My assignment is to get differential gene expression analysis. But I'm not really sure what it...is just the list of genes. 2) What is MA plot and what does it have to do with differential expression analysis? I've read some papers about RNA-Seq...and R package…

deseq2 bioinformatics rna-seq Tutorial

updated 9.3 years ago • fromhj304

that the current s.serevisiae S288C_R64 annotation set is 3.1. http://sgd-archive.yeastgenome.org/sequence/S288C_reference/genome_releases/ but the org.Sc.sgd.db is 2.1. Somewhat related, I have been trying to test out...ALIAS" "COMMON" "DESCRIPTION" "ENSEMBL" "ENSEMBLPROT" "ENSEMBLTRANS" "ENTREZID" "ENZYME" "EVIDENCE" [10] "EVIDENCEALL" "GENENAME" …

GeneTonic org.Sc.sgd.db pcaExplorer topGO EnrichmentBrowser

updated 3.9 years ago • chase.mateusiak

I have two questions here. The first one is basically about how to use narrow() to keep the wanted sequence in an efficient way. I have a read and corresponding cigar, a subset from my `` GAlignments `` instance. I want to clip the...1] 1 47 47 [2] 49 100 52</pre> Then I want to keep the sequence from 1 to 47 and 49 to 100. I don't know how to d…

genomicalignments narrow mismatch

updated 9.0 years ago • Chao-Jen Wong

div class="preformatted">Hi, Very much a newbie here. I'm looking for a way to input a gene id, such as 'ENSG00000163346' and determine whether it might be ribosomal. Anybody familiar with a way to accomplish this...with a few lines of code? I'd be most greatful. Thanks, Jonathan </div

updated 14.7 years ago • Jonathan