Bioconductor Forum

column: #> seqnames ranges strand | name1 #> <rle> <iranges> <rle> | <character> #> [1] I 5-10 + | myquery #> ------- #> seqinfo: 1 sequence from an unspecified genome; no seqlengths gr2 #> GRanges object with...column: #> seqnames ranges strand | name2 #&a…

plyranges

updated 11 months ago • alexis.weinreb

ExpressionSet (storageMode: lockedEnvironment) assayData: 20172 features, 60 samples element names: exprs, se.exprs protocolData sampleNames: GSM330151.CEL GSM330153.CEL ... GSM331677.CEL (60 total) varLabels: ScanDate...5 cross-validation loops finished. <span style="background-color:Yellow">Error in (function (cl, name, valueClass) : assignment of an object o…

software error geNetClassifier

updated 9.3 years ago • polemiraza

comunity. I'm new with Bioconductor so probably my question is very basic. I have a list of gene names from a proteomic analysis we've run in the lab. I need to obtain the GO annotations of the genes (from Rattus norvergicus...I have in my list. The rownames of my expression set object is: ``` > Gene names head(rownames(AverageDataSet)) [1] "Emc2" "GLTP" "Nceh1" "Erlin2" "At…

org.Rn.eg.db annotation go

updated 5.8 years ago • jose.wo

Hi, all,       I aligned my RNAseq raw data to cDNA using Kallisto and import the result using _tximport_ as suggested by the DESeq2 tutorial (tx2gene maps ensembl\_transcript\_id to ext\_gene symbol) <pre> txi.kallisto_gene <- tximport(files, type = "kallisto", tx2gene=tx2gene,ignoreTxVersion=TRUE)</pre> When I looked into the &…

deseq2

updated 4.9 years ago • Raymond

nbsp;         seqnames    ranges strand |        name                   <Rle> <IRanges>  <Rle> | <character>      &…

r granges grange

updated 7.3 years ago • g.k

Dear all, please could you advise : how does MAFTOOLS treat the annovar files with the gene names ? For examples, shall I have a file (below), the questions would be : <span style="background-color:Yellow">> head(var.annovar.maf

maftools

updated 8.9 years ago • Bogdan

REF ALT QUAL FILTER <dnastringset> <characterlist> <numeric> <character> 1 T .AAAAAAAAAAAAAAAAAAA.. 4115.21 PASS > fixedMatch DataFrame with 1 row and 4 columns REF ALT QUAL FILTER <dnastringset...characterlist> <numeric> <character> 1 …

VariantAnnotation

updated 5.1 years ago • Dario Strbenac

genome information (try:0) Using: Homo sapiens genes (GRCh37.p13) Error in fix.by(by.y, y) : 'by' must specify a uniquely valid column</pre> Here is my code that I want to use to download and prepare the expression data of the

TCGA tcgabiolinks Error

updated 8.5 years ago • f.geist

Hello. I was kindly asking how I can convert "Majority protein IDs" to "Gene names" like so: Majority.protein.IDs A0AV96-2;B7Z8Z7;A0AV96;D6R9D6;D6RBS9 A0AVT1;A0AVT1-2 A1L0T0;M0R026 A1XBS5-5;E5RHK0...Hello. I was kindly asking how I can convert "Majority protein IDs" to "Gene names" like so: Majority.protein.IDs A0AV96-2;B7Z8Z7;A0AV96;D6R9D6;D6RBS9 A0AVT1;A0AVT1-2 …

MassSpectrometryData Proteome Database DEP

updated 4.8 years ago • tpm

I'm not sure what Im doing wrong since I have used the code many times before the row names doesn't show up although that is assigned to in my code. I have tried putting the row-name both left and right side but it...100) myBreaks <- seq(-0.5, 0.5, length.out=100) myBreaks hmap <- Heatmap(heat, name="Z-score", col=colorRamp…

ComplexHeatmap

updated 3.6 years ago • krushnach80

same input sequences defined differently in terms of classes (see showMethods below): for pattern="character", subject="character" vs. pattern="DNAString", subject="DNAString" ? It generates the same outcomes for the case of pattern...character", subject="character" vs. pattern="character", subject="DNAString" It looks like a bug. Thanks Alex #showMethods("pairwiseAlignment...Functi…

updated 14.8 years ago • Alogmail2@aol.com

Hello, I am trying to convert ensembl ids to gene names or gene symbol before analysis. How I will convert this? And how I convert in the results file from DESeq2 or EdgerR

ensemblid

updated 6.1 years ago • rajeshparmar4

<div class="preformatted">Hi Aaron, The "R magic" is to use do.call() function. Check the manual for more details on its functionality. The only 'trick' here is to build the second argument. > data(GOdata) > data(results.tGO) > ls() [1] "GOdata" "resultFisher" "resultKS" > res <- list(fisher = resultFisher, ks = resultKS) > do.call(GenTabl…

GO PROcess topGO GO PROcess topGO

updated 12.9 years ago • Adrian Alexa

gt; From: Daniel Brewer <daniel.brewer at="" icr.ac.uk=""> > Subject: [BioC] How to check if gene name is an alias or misspelt > To: Bioconductor mailing list <bioconductor at="" stat.math.ethz.ch=""> > Message-ID: <49DCAC07.6010804

Cancer convert Cancer convert

updated 16.7 years ago • Gordon Smyth

chromosomal locations indicating genes but I don't know how I map this location into specific gene names. > head(pns) [1] "chr19:4205395-4220723" "chr16:73793547-73835933" [3] "chr22:18115791-18146966" "chr19:60540822-60563218" [5] "chr16

Lung charm genomes Lung charm genomes

updated 13.5 years ago • Yoo, Seungyeul

H3K4me3\_narrow) \#\#\# error massage: <span style="background-color:Yellow">_"Repeated column names found in count matrix"_</span> best sajjad   &nbsp

diffbind

updated 10.2 years ago • khani.sajjad

for atomic and list types The problem has probably to do with that "genome" is not considered as a character vector of my HIV sequences input bam file. Does that make sense? would you have any suggestion?  Please let me know

bam file HIV cytosine

updated 8.2 years ago • achaillon

gt;kao dbGetQuery(kao,"SELECT * from featureSet limit 100")$"man_fsetid"->probesets result<-vector("list",length(probesets)) names(result)<-probesets for(ind in 1:length(result)){ dbGetQuery(kao,paste("SELECT * from featureSet...where man_fsetid='",names(result)[ind],"'",sep=""))$fsetid->fsetid dbGetQuery(kao, paste("select * from pmfeature where fsetid=",fsetid,se…

updated 17.0 years ago • li lilingdu

10000L, 10000L, 10000L, 10000L, 10000L, 10000L, 10000L, 10000L) , NAMES = NULL , elementType = "integer" , elementMetadata = NULL , metadata = list() ) , strand = new("Rle" , values = structure(3L, .Label = c("+", "-", "*"), class = "factor...6.21, 0, 0, 0)…

rtracklayer

updated 10.4 years ago • liz.ingsimmons

Hi, I've been following the example for using __GOstats__ at its manual at __https://www.bioconductor.org/packages/release/bioc/vignettes/GOstats/inst/doc/GOstatsForUnsupportedOrganisms.pdf.__ Unfortunately I have an error <pre> <em>Error in initialize(value, ...) : invalid names for slots of class “GOHyperGResult”: pvalues, oddsRatios, expectedCounts, catToGeneId, organism</…

GOstat GOstats

updated 9.6 years ago • ccanchaya

You could use getBM function in >> biomaRt >> package to convert ensembl_ID to gene name or other IDs if needed. >> >> Best regards, >> >> Julie > > </pablo.echeverria></div

Annotation AnnotationData annotate convert biomaRt Annotation AnnotationData annotate

updated 15.0 years ago • Julie Zhu

Hello everyone, I compared 2 examples to find a list of common genes. Once I have found the common genes, I would like to find out the main processes to which these genes belong. I have an excel or CSV file with a table with a list of genes, the name of each gene and its GOs number. I do not have statistical information on each gene, how can I find the main processes/GO to...to which these gene…

GeneSetEnrichment genes genetogo

updated 3.6 years ago • Noy

I am writing a unitary test with [testthat](https://cran.r-project.org/web/packages/testthat/index.html) for a function handling VCF files. However, I encounter a problem with `` ref(vcf) ``, which comes from `` DNAStringSet@ranges@start ``. __Edit:__ more specifically,`` expect_equal(as.character(ref(observed)), as.character(ref(expected))) `` passes, but `` expect_equal(ref(observed)…

vcf testthat dnastringset

updated 10.2 years ago • TimothéeFlutre

region ctg123 1 1497228", "\nctg123\t.\tgene\t1000\t9000\t.\t+\t.\tID=gene00001;Name=EDEN", "\nctg123\t.\tmRNA\t1050\t9000\t.\t+\t.\tID=mRNA00001;Parent=gene00001", "\nctg123\t.\texon\t1050\t1500\t.\t+\t.\tParent=mRNA00001...ranges strand | gene_id <Rle> <IRanges> <Rle> | <charac…

maketxdbfromgff genomicfeatures

updated 9.7 years ago • TimothéeFlutre

as a row-major matrix (double\*). Then, I have a SEXP vector to which I would like to attach each row to __without having to copy__ data from each row individually to new to-be-attached...SEXP vectors. I know that SET\_VECTOR\_ELT can be used to attach a SEXP vector to another SEXP list. However, since the data coming from...the GPU is not stored in SEXP vectors, I wouldn't be able to use SET\_V…

R C++

updated 9.2 years ago • Mohammad Alkhamis

strong written and verbal communication skills. He/she must have a minimum of five years of relevant experience in data science, and demonstrate experience with algorithms for...as application of advanced data analytics, including data mining and visualization. The incumbent must demonstrate deep understanding of database design and structure. Experience should include work with applications...ba…

bioinformatics Job

updated 9.2 years ago • kaufmanm

wanted to modify hyperGTest for my project, but I cannot seem to find > any relevant code. There must be some secret to names for functions > for this type of thing - please point me in the right direction. As Jim pointed out

GO Cancer GOstats Category GO Cancer GOstats Category

updated 18.7 years ago • Seth Falcon

GenomicRanges" package to generate "GRanges" objects, but I would like these objects to have "REFSEQ" names rather than UCSC-style names.  This gives me UCSC-style names:  library(OrganismDbi) a1 <- promoters(Mus.musculus

promoter granges refseq ucsc organismdb

updated 10.1 years ago • efoss

Hi all, I'm trying to get ELMER running on some of my own EPIC/RNAseq data but first I need to get the example working. I'm encountering an error simply following the example, am I missing packages? (sessioninfo below): > library(ELMER) > # example input > met <- matrix(rep(0,15),ncol = 5) > colnames(met) <- c("Sample1", …

ELMER

updated 6.5 years ago • D

div class="preformatted">An embedded and charset-unspecified text was scrubbed... Name: not available Url: https://stat.ethz.ch/pipermail/bioconductor/attachments/20070731/ 2df773a1/attachment.pl</div

updated 18.4 years ago • Alex Tsoi

to `` y <- DGEList(counts=rawCountTable, group=group, genes = merged.descriptions) `` the gene names have replaced by numbers > logCPM <- cpm(y, prior.count=2, log=TRUE) > head(y$genes) gene_name gene_description 3 sp0000003...both", cexRow=0.6, cexCol=0.6, density.info="none") How is it possible to get back …

heatmap.2 edger

updated 8.2 years ago • mictadlo

object with 654611 ranges and 6 metadata columns: seqnames ranges strand | name score signalValue pValue qValue peak <Rle> <IRanges> <Rle> | <character> <numeric> <numeric> <numeric

roadmap project annotationhub epigenomics big data

updated 9.7 years ago • kevin.rue

<div class="preformatted">|transformList| is what you are looking for: |tl <- transformList(c("FL1-H","FL2-H"), log) colnames(tl) data(GvHD) transform(GvHD[[1]], tl)| Mike Jiang On 11/19/2013 01:00 PM, Liu, Hongye wrote: > Dear Dr. Jiang, > > How are you? I am a new user of flowCore and I have run into a problem > which I hope you can help me. >…

flowCore flowCore

updated 12.1 years ago • Jiang, Mike

Hi, I am trying to plot some data in R using the Gviz package, but I can't seem to get the gene names to appear on the track nor can I get the ideogram function to work. For the ideogram, I am aware that the yeast genome does...chromosome = chr) Error in .local(.Object, ...) : Failed to obtain 'hguid' cookie ``` For gene names, I would like to have them on top of the yellow bars indi…

gviz Saccharomyces_cerevisiae Gviz ideogram

updated 2.3 years ago • Michael

fold change : res_log2FC <- arrange(IHW5_sign, desc(IHW5_sign$log2FoldChange)) # I created a vector of the gene accession numbers genes <- res_log2FC$row genes <- factor(genes, levels=genes) 1765 Levels: FBgn0000356...FBgn0052644 FBgn0031621 FBgn0000644 ... FBgn0036600 gene_names<-as.factor(res_log2FC$name) # a vector containing the gene names that I assigned to the …

DESeq2 heatmaps

updated 7 months ago • caroline.zanchi

my data: > limma2annaffy(gcrma.pres, fit2, design, annotation(gcrma.pres),pfilt=0.05) Error in vector("list", dim(contrast)[2]) : negative length vectors are not allowed When I try naming the annotation(gcrma.pres) argument...this: > limma2annaffy(gcrma.pres, fit2, design, lib=annotation(gcrma.pres),pfilt=0.05) Error in vector("list", dim(contrast)[2]) : argum…

GO Survival Biobase annotate genefilter geneplotter affy affydata graph limma annaffy

updated 18.8 years ago • Jenny Drnevich

accepted\_hits\_selected.bam ...  Execution halted We've discovered that the database names are changed, while in the biomaRT package they did not update those names...   Can anyone please help us? &nbsp

biomaRT database

updated 10.9 years ago • aspadotto

gt; library(arrayQuality) > maQualityPlots(mraw) Error in match.arg(antialias, aa.win) : 'arg' must be of length 1 > maQualityPlots(mraw, save=F) Error in as.double(y) : cannot coerce type 'S4' to vector of type 'double' #a single

updated 12.9 years ago • Pavlík Vojtěch

<div class="preformatted">Dear All, I came across the following error in DNAStringSet from the Biostrings package: > myseq = "CTATGTGTGAGGGCAGCAACCAGAACTGTCTGCCCTGACTTCGCTCAGGATGCTGTGAACATGTGGCTC AGATGGTGCTAGGCATTTTCCTCTAGAGTCAGAAACGTGGACAGAGAGTCATCTCCTCTGGCTTCCCAGG CATGTCTGCCACTCTGAAGGTCTGAAGGTCTGGGTCTCCCTCCCATGGGATTTGAGTGCAGAGAGCTGTG TGACTGGGTCCCTTCAGATCCAGGTGGTGTCTGGACTGTAGCGTTG…

BSgenome BSgenome BSgenome BSgenome

updated 15.2 years ago • arne.mueller@novartis.com

Error in switch(alphabet, ACGT = "DNA", ACGU = "RNA", ACDEFGHIKLMNPQRSTVWY = "AA", : EXPR must be a length 1 vector</pre> Is there something wrong with the format of my input file?  Is there an example input file with

motifstack meme

updated 7.8 years ago • aramp10

<div class="preformatted">I am trying to follow the "Load Data" Vignette in the section entitled "quality control through data exploration". I am using R1.7.1 and updated Bioconductor Tuesday (yesterday) on a Windows XP machine. I have 23 U133A chips that I am trying to examine. As I followed the process I was able to do all the actions (histogram, boxplot, RNA degradation plot) on my da…

PROcess PROcess

updated 22.4 years ago • Michael Barnes

length 16576709 bytes (15.8 MB) downloaded 15.8 MB Error in unzip(basename(bin)) : invalid zip name argument In addition: Warning message: In if (grepl("^https?://", url)) { : the condition has length > 1 and only the first element will

tcgabiolinks gdcdownload unzip

updated 8.0 years ago • fawazfebin

function at the bottom of my email, for doing this. * Since start, end, width are reserved column names for GRanges, it would be nice if the GRanges constructor was extended to allow GRanges(seqnames = "chr1", start = 1, end = 10) instead...contigs (like "chr10_random") are part of the data sources. I would have preferred it to be a character and then have seqlengths essentially be NA in case…

updated 15.3 years ago • Kasper Daniel Hansen

up and down regulated genes, but when I run it it says: Error in `check_aesthetics()`: ! Aesthetics must be either length 1 or the same as the data (499): colour This is my code: ``` keyvals <- ifelse(p$log2FoldChange < -0.5 & p$padj...gt; 0.5 & p$padj > 0.05, 'mediumpurple', "black")) keyvals[is.na(keyvals)] <- 'black' names(keyvals)[keyvals == 'dar…

EnhancedVolcano

updated 3.2 years ago • patrirodry85

file="targets.txt",path="C:\\Playground\\Micro") #This is the object > target SlideNumber Name FileName Cy3 Cy5 array1 1 c1 array1.xls control treatment array2 2 c2 array2.xls control treatment #and how I use the...source2, quantarray = { : could not find function "readBlueFuseHeader" #I've also tried to use a vector with file names instead of …

limma limma

updated 19.5 years ago • Alessio Venier

seqnames ranges strand | type source phase <rle> <iranges> <rle> | <character> <character> <character> [1] chr1 [1310534, 1310770] - | exon Cufflinks_C4 NA conf_hi conf_lo cov FPKM frac ID Parent <numeric...numeric> <numeric> <numeric> <numeric>…

rtracklayer rtracklayer

updated 14.7 years ago • Kathi Zarnack

I remember there is a website where you can type in affy probe set ID and it will give you the gene name, could anybody tell me what it is? Thanks, -James [[alternative HTML version deleted]] </div

probe affy probe affy

updated 15.8 years ago • James Anderson

I have expression data with Affymetrix hg u133 plus 2 probeset IDs & gene set data with gene names. So both gene set and expression data are not using the same gene ID system which is a requirement to run the GAGE analysis...So the problem is that if i convert the Probeset IDs to gene name, i get a single gene name for multiple probes. So the expression data will now have multiple rows wi…

convert gage convert gage

updated 13.8 years ago • Javerjung Sandhu

the data is numeric, but when I put it to the destination variable/file, I get this error: Error: R character data can only be written to NC\_CHAR variable I have appended the command lines I have used.  I think that my problem...refers to the DESTINATION cdf file > var.inq.nc(CDF1,"a\_d\_sampling\_rate") $id \[1\] 1 $name \[1\] "a\_d\_sampling\_rate" $type \[1\] …

mzr RNetCDF bioconductor

updated 8.9 years ago • ray.bacala

lt;- unlist(promoter.seqs)> promoter.seqs A DNAStringSet instance of length 8 width seq names [1] 1500 CTGCTGTAAAGTTACATTCCTGCCTAGAAATTTATATCGA TTCTGCCGTCAGAA...GGAGGGAAGCGCCGGGCTGTGTCACGTGACGGGTGCGCCGGGCGTTGGCTCCT

updated 11.3 years ago • deepti anand

<div class="preformatted">Ann, heres a function to extract a vector of dfs using the input objects X, and classlabel inputs for mt.teststat. welchdf <- function(X, classlabel) { varx1 <- apply...div class="preformatted">Ann, heres a function to extract a vector of dfs using the input objects X, and classlabel inputs for mt.teststat. welchdf <- function(X, cla…

multtest multtest

updated 22.3 years ago • Marcus Davy

gt; [1] "YCL019W" "YCL020W" "YER160C" "YJR026W" "YJR028W" "YML045W" >> class(selGenes) > [1] "character" >> library("GOstats") >> library("YEAST") >> set.seed(434) >> allYeast <- ls(YEASTCHR) Hmm, it doesn't look like...lt;- hyperGTest(p) > Error in order(na.last, decreasing, ...) : &gt…

Cancer GOstats Cancer GOstats

updated 18.7 years ago • Seth Falcon

I'm trying to run the ChAMP SVD analysis, however I get an error which I don't fully understand. Anyone who does and knows how to solve? ``` dir.create('./CHAMP_SVDimages') champ.SVD(beta = mynormSPN, rgSet=NULL, pd=myloadSPN$pd, RGEffect=FALSE, PDFplot=TRUE, Rplot=TRUE, resultsDir="./CHAMP_SVDimages/SPN") [==============…

ChAMP

updated 4.5 years ago • FWNL15

Hi everyone I am trying to do the plotCounts function in DESeq2 and have a question on how to plot for a specific gene that i am interested in.  Wherever i look the codes that is recommended is: <pre> plotCounts(dds, gene=which.min(res$padj), intgroup="dex") plotCounts(dds, gene="ENSG____", intgroup="dex")</pre> What code would you use to make the plotCounts using the…

deseq2

updated 9.7 years ago • Antonio Ahn

value of 'files' before using the read.maimages() function. Does 'files' contain the required file names? Please read ?read.maimages to see what format 'files' must be in. Gordon >thanks </gusnahab></div

limma limma

updated 20.4 years ago • Gordon Smyth

fitExtractVarPartModel(Filt_EXP1, form, clin) Error: number of levels of each grouping factor must be < number of observations > form <- ~ (0|submitter_id) > varPart <- fitExtractVarPartModel(Filt_EXP1, form, clin) Error...in (function (cl, name, valueClass) : assignment of an object of class “numeric” is not valid for @‘Dim’ i…

variance formula expression

updated 6.9 years ago • rina

BioMark", n.features = 96, n.data = 96)<br/> Error in `$<-.data.frame`(`*tmp*`, Call, value = character(0)) :<br/>   replacement has 0 rows, data has 9216</code> Then I used a post found here: <https://support.bioconductor.org...1: In .readCtPlain(readfile = readfile, header = header, n.features = n.features, : 96 gene names (rows) expected, got 920…

htqpcr bioconductor fluidigm biomark

updated 7.8 years ago • reed27

fans !! This is how my sample bed files looks like: <pre> seqnames ranges strand | name score <Rle> <IRanges> <Rle> | <character> <numeric> [1] chr1 [ 32727, 32817] * | MACS_peak_1 8.69 [2] chr1 [ 52489, 52552

r bioinformatics peakset

updated 10.0 years ago • Jurat Shahidin

phase gene_id transcript_id exon_number gene_name <integer> <character> <character> <character> <character> [1] <NA> ENSG00000236896 ENST00000411981 1 RP11-535C21.3 [2...2 RP11-535C21.3 gene_biotype transcript_name exon_id protein_id &am…

annotationhub

updated 9.0 years ago • mviterson

gt; colData DataFrame with 6 rows and 5 columns viewpoint condition replicate <character> <factor> <numeric> 1 Smad4a Q30 1 2 Smad4a Q30 2 3 Smad4a Q30_c1 1 4 Smad4a Q30_c1 2 5 Smad4a Q30_uniq_srt...bamFile sequencingPrimer …

FourCseq fourcseq

updated 10.6 years ago • theodore.georgomanolis